EMAIL THIS PAGE TO A FRIEND

RBP2

retinol binding protein 2, cellular

50 Gene Product Result for
Synonyms: CRABP-II CRBP2 CRBPII RBPC2
UniProtKB ID: P50120, A8K7G3, Q6ISQ9, Q6ISS7
Gene ID:
Human(5948) Summary: RBP2 is an abundant protein present in the small intestinal epithelium. It is thought to participate in the uptake and/or intracellular metabolism of vitamin A. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. RBP2 may also modulate the supply of retinoic acid to the nuclei of endometrial cells during the menstrual cycle. [provided by RefSeq, Jul 2008]
Mouse(19660) retinol binding protein 2, cellular
Rat(24710) retinol binding protein 2, cellular
fruit fly(49809) RNA-binding protein 2
Horse(100051689) retinol binding protein 2, cellular
domestic cat(101090712) retinol binding protein 2, cellular
dog(477089) retinol binding protein 2, cellular
chicken(424822) retinol binding protein 2, cellular
cow(616639) retinol binding protein 2, cellular
sheep(101108710) retinol binding protein 2, cellular
domestic guinea pig(100733346) retinol binding protein 2, cellular
naked mole-rat(101718467) retinol binding protein 2, cellular
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009034 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009034 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009034 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004164 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004164 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004164 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU011951 MISSION® esiRNA esiRNA targeting human RBP2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004164 Rosetta Predictions human pricing
NM_012640 Rosetta Predictions rat pricing
NM_009034 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158664 predicted 290
2 SASI_Hs01_00158665 predicted 206
3 SASI_Hs02_00337028 predicted 302
4 SASI_Hs01_00158666 predicted 272
5 SASI_Hs01_00158667 predicted 224
6 SASI_Hs02_00337029 predicted 308
7 SASI_Hs01_00158668 predicted 272
8 SASI_Hs01_00158669 predicted 212
9 SASI_Hs01_00158672 predicted 460
10 SASI_Hs01_00158673 predicted 426
11 SASI_Hs01_00158670 predicted 364
12 SASI_Hs01_00158671 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012640 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044878 predicted 221
2 SASI_Rn01_00044879 predicted 210
3 SASI_Rn02_00259877 predicted 326
4 SASI_Rn01_00044880 predicted 413
5 SASI_Rn01_00044881 predicted 220
6 SASI_Rn01_00044882 predicted 225
7 SASI_Rn01_00044883 predicted 424
8 SASI_Rn01_00044884 predicted 322
9 SASI_Rn02_00259878 predicted 385
10 SASI_Rn01_00044887 predicted 206
11 SASI_Rn01_00044885 predicted 288
12 SASI_Rn01_00044886 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009034 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166422 predicted 223
2 SASI_Mm02_00315190 predicted 209
3 SASI_Mm01_00166424 predicted 328
4 SASI_Mm01_00166425 predicted 286
5 SASI_Mm01_00166426 predicted 279
6 SASI_Mm02_00315191 predicted 279
7 SASI_Mm01_00166427 predicted 283
8 SASI_Mm01_00166428 predicted 286
9 SASI_Mm01_00166429 predicted 261
10 SASI_Mm01_00166430 predicted 232
11 SASI_Mm01_00166421 predicted 341
12 SASI_Mm01_00166423 predicted 335
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009034
VALIDATED
RBP2 MISSION shRNA Bacterial Glycerol Stock
retinol binding protein 2, cellular
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009034.3-334s21c1
Sequence:CCGGACCCTCGTGTGTGTGCATAAACTCGAGTTTATGCACACACACGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009034.3-115s21c1
Sequence:CCGGTACATGAAGGCCCTAGATATTCTCGAGAATATCTAGGGCCTTCATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105570    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009034.2-477s1c1
Sequence:CCGGGCCTGGAACATGTGCAGAGTTCTCGAGAACTCTGCACATGTTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009034.2-434s1c1
Sequence:CCGGGTGTGCCGACAAGTGTTCAAACTCGAGTTTGAACACTTGTCGGCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009034.2-196s1c1
Sequence:CCGGCGGTGATAACTTCAAGACGAACTCGAGTTCGTCTTGAAGTTATCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009034.2-173s1c1
Sequence:CCGGCAGACGAAGATCATCACTCAACTCGAGTTGAGTGATGATCTTCGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009034.4-130s21c1
Sequence:CCGGCTACATGAAGGCCCTAGATATCTCGAGATATCTAGGGCCTTCATGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009034.4-105s21c1
Sequence:CCGGTGGAGAGTAATGAGAACTTTGCTCGAGCAAAGTTCTCATTACTCTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009034.3-433s21c1
Sequence:CCGGGTGTGCCGACAAGTGTTCAAACTCGAGTTTGAACACTTGTCGGCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009034.2-114s1c1
Sequence:CCGGGCTACATGAAGGCCCTAGATACTCGAGTATCTAGGGCCTTCATGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009034.3-231s21c1
Sequence:CCGGCCGCAACTACGACCTGGATTTCTCGAGAAATCCAGGTCGTAGTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009034.3-476s21c1
Sequence:CCGGGCCTGGAACATGTGCAGAGTTCTCGAGAACTCTGCACATGTTCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009034
VALIDATED
RBP2 MISSION shRNA shRNA Plasmid DNA
retinol binding protein 2, cellular
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009034.3-334s21c1
Sequence:CCGGACCCTCGTGTGTGTGCATAAACTCGAGTTTATGCACACACACGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009034.3-115s21c1
Sequence:CCGGTACATGAAGGCCCTAGATATTCTCGAGAATATCTAGGGCCTTCATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105570    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009034.2-477s1c1
Sequence:CCGGGCCTGGAACATGTGCAGAGTTCTCGAGAACTCTGCACATGTTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009034.2-434s1c1
Sequence:CCGGGTGTGCCGACAAGTGTTCAAACTCGAGTTTGAACACTTGTCGGCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009034.2-196s1c1
Sequence:CCGGCGGTGATAACTTCAAGACGAACTCGAGTTCGTCTTGAAGTTATCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009034.2-173s1c1
Sequence:CCGGCAGACGAAGATCATCACTCAACTCGAGTTGAGTGATGATCTTCGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009034.4-130s21c1
Sequence:CCGGCTACATGAAGGCCCTAGATATCTCGAGATATCTAGGGCCTTCATGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009034.4-105s21c1
Sequence:CCGGTGGAGAGTAATGAGAACTTTGCTCGAGCAAAGTTCTCATTACTCTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009034.3-433s21c1
Sequence:CCGGGTGTGCCGACAAGTGTTCAAACTCGAGTTTGAACACTTGTCGGCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009034.2-114s1c1
Sequence:CCGGGCTACATGAAGGCCCTAGATACTCGAGTATCTAGGGCCTTCATGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009034.3-231s21c1
Sequence:CCGGCCGCAACTACGACCTGGATTTCTCGAGAAATCCAGGTCGTAGTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009034.3-476s21c1
Sequence:CCGGGCCTGGAACATGTGCAGAGTTCTCGAGAACTCTGCACATGTTCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009034
VALIDATED
RBP2 MISSION shRNA Lentiviral Transduction Particles
retinol binding protein 2, cellular
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009034.3-334s21c1
Sequence:CCGGACCCTCGTGTGTGTGCATAAACTCGAGTTTATGCACACACACGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009034.3-115s21c1
Sequence:CCGGTACATGAAGGCCCTAGATATTCTCGAGAATATCTAGGGCCTTCATGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105570    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009034.2-477s1c1
Sequence:CCGGGCCTGGAACATGTGCAGAGTTCTCGAGAACTCTGCACATGTTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009034.2-434s1c1
Sequence:CCGGGTGTGCCGACAAGTGTTCAAACTCGAGTTTGAACACTTGTCGGCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009034.2-196s1c1
Sequence:CCGGCGGTGATAACTTCAAGACGAACTCGAGTTCGTCTTGAAGTTATCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009034.2-173s1c1
Sequence:CCGGCAGACGAAGATCATCACTCAACTCGAGTTGAGTGATGATCTTCGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009034.4-130s21c1
Sequence:CCGGCTACATGAAGGCCCTAGATATCTCGAGATATCTAGGGCCTTCATGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009034.4-105s21c1
Sequence:CCGGTGGAGAGTAATGAGAACTTTGCTCGAGCAAAGTTCTCATTACTCTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009034.3-433s21c1
Sequence:CCGGGTGTGCCGACAAGTGTTCAAACTCGAGTTTGAACACTTGTCGGCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009034.2-114s1c1
Sequence:CCGGGCTACATGAAGGCCCTAGATACTCGAGTATCTAGGGCCTTCATGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009034.3-231s21c1
Sequence:CCGGCCGCAACTACGACCTGGATTTCTCGAGAAATCCAGGTCGTAGTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312001    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009034.3-476s21c1
Sequence:CCGGGCCTGGAACATGTGCAGAGTTCTCGAGAACTCTGCACATGTTCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004164
RBP2 MISSION shRNA Bacterial Glycerol Stock
retinol binding protein 2, cellular
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004164.2-160s21c1
Sequence:CCGGCTCACTCAGACGAAGGTTATTCTCGAGAATAACCTTCGTCTGAGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004164.2-282s21c1
Sequence:CCGGCCTGGATAACCGGCATGTTAACTCGAGTTAACATGCCGGTTATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004164.2-108s1c1
Sequence:CCGGCTACATGAAGGCCCTGGATATCTCGAGATATCCAGGGCCTTCATGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004164.2-215s21c1
Sequence:CCGGCTAGCACATTCCGCAACTATGCTCGAGCATAGTTGCGGAATGTGCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004164.2-270s1c1
Sequence:CCGGGTACACAAAGAGCCTGGATAACTCGAGTTATCCAGGCTCTTTGTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004164.2-427s1c1
Sequence:CCGGGTGTGCCGTCAAGTGTTCAAACTCGAGTTTGAACACTTGACGGCACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004164.2-159s1c1
Sequence:CCGGTCTCACTCAGACGAAGGTTATCTCGAGATAACCTTCGTCTGAGTGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004164.2-110s21c1
Sequence:CCGGACATGAAGGCCCTGGATATTGCTCGAGCAATATCCAGGGCCTTCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004164
RBP2 MISSION shRNA shRNA Plasmid DNA
retinol binding protein 2, cellular
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004164.2-160s21c1
Sequence:CCGGCTCACTCAGACGAAGGTTATTCTCGAGAATAACCTTCGTCTGAGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004164.2-282s21c1
Sequence:CCGGCCTGGATAACCGGCATGTTAACTCGAGTTAACATGCCGGTTATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004164.2-108s1c1
Sequence:CCGGCTACATGAAGGCCCTGGATATCTCGAGATATCCAGGGCCTTCATGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004164.2-215s21c1
Sequence:CCGGCTAGCACATTCCGCAACTATGCTCGAGCATAGTTGCGGAATGTGCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004164.2-270s1c1
Sequence:CCGGGTACACAAAGAGCCTGGATAACTCGAGTTATCCAGGCTCTTTGTGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004164.2-427s1c1
Sequence:CCGGGTGTGCCGTCAAGTGTTCAAACTCGAGTTTGAACACTTGACGGCACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004164.2-159s1c1
Sequence:CCGGTCTCACTCAGACGAAGGTTATCTCGAGATAACCTTCGTCTGAGTGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004164.2-110s21c1
Sequence:CCGGACATGAAGGCCCTGGATATTGCTCGAGCAATATCCAGGGCCTTCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004164
RBP2 MISSION shRNA Lentiviral Transduction Particles
retinol binding protein 2, cellular
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004164.2-160s21c1
Sequence:CCGGCTCACTCAGACGAAGGTTATTCTCGAGAATAACCTTCGTCTGAGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004164.2-282s21c1
Sequence:CCGGCCTGGATAACCGGCATGTTAACTCGAGTTAACATGCCGGTTATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004164.2-108s1c1
Sequence:CCGGCTACATGAAGGCCCTGGATATCTCGAGATATCCAGGGCCTTCATGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004164.2-215s21c1
Sequence:CCGGCTAGCACATTCCGCAACTATGCTCGAGCATAGTTGCGGAATGTGCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004164.2-270s1c1
Sequence:CCGGGTACACAAAGAGCCTGGATAACTCGAGTTATCCAGGCTCTTTGTGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004164.2-427s1c1
Sequence:CCGGGTGTGCCGTCAAGTGTTCAAACTCGAGTTTGAACACTTGACGGCACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004164.2-159s1c1
Sequence:CCGGTCTCACTCAGACGAAGGTTATCTCGAGATAACCTTCGTCTGAGTGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004164.2-110s21c1
Sequence:CCGGACATGAAGGCCCTGGATATTGCTCGAGCAATATCCAGGGCCTTCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)