EMAIL THIS PAGE TO A FRIEND

RBP4

retinol binding protein 4, plasma

71 Gene Product Result for
Synonyms: RDCCAS
Gene ID:
Human(5950) Summary: This protein belongs to the lipocalin family and is the specific carrier for retinol (vitamin A alcohol) in the blood. It delivers retinol from the liver stores to the peripheral tissues. In plasma, the RBP-retinol complex interacts with transthyretin which prevents its loss by filtration through the kidney glomeruli. A deficiency of vitamin A blocks secretion of the binding protein posttranslationally and results in defective delivery and supply to the epidermal cells. [provided by RefSeq, Jul 2008]
Mouse(19662) retinol binding protein 4, plasma
Rat(25703) retinol binding protein 4, plasma
fruit fly(41668) RNA-binding protein 4
Zebrafish(30077) retinol binding protein 4, plasma
chicken(396166) retinol binding protein 4, plasma
Horse(100049790) retinol binding protein 4, plasma
domestic cat(101094377) retinol binding protein 4, plasma
dog(477775) retinol binding protein 4, plasma
cow(281444) retinol binding protein 4, plasma
sheep(101105458) retinol binding protein 4, plasma
domestic guinea pig(100725967) retinol binding protein 4, plasma
naked mole-rat(101701666) retinol binding protein 4, plasma
Domestic Rabbit(100009161) retinol binding protein 4, plasma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1104955 Anti-RBP4 (161-175) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB2500876 Anti-RBP4 (Internal) antibody produced in goat affinity isolated antibody, buffered aqueous solution canine, rat, mouse, human
ELISA, western blot pricing
SAB2500875 Anti-RBP4 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, canine, human, mouse
ELISA, western blot pricing
SAB1406378 Anti-RBP4 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1412157 ANTI-RBP4 antibody produced in mouse clone 4D9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1412158 ANTI-RBP4 antibody produced in mouse clone 3D12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
HPA001641 Anti-RBP4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2104717 Anti-RBP4, (N-terminal) antibody produced in rabbit affinity isolated antibody mouse, human, horse, rat, pig
immunohistochemistry, western blot pricing
WH0005950M2 Monoclonal Anti-RBP4 antibody produced in mouse clone 4H7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB5300391 Monoclonal Anti-RBP4 antibody produced in mouse clone 4C2, ascites fluid human
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404304 Monoclonal Anti-RBP4, (C-terminal) antibody produced in mouse clone 1E9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011255 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011255 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011255 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006744 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006744 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006744 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006744 Rosetta Predictions human pricing
NM_013162 Rosetta Predictions rat pricing
NM_011255 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006744 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141628 predicted 349
2 SASI_Hs01_00141629 predicted 636
3 SASI_Hs01_00141630 predicted 579
4 SASI_Hs01_00141631 predicted 452
5 SASI_Hs01_00141633 predicted 618
6 SASI_Hs01_00141634 predicted 413
7 SASI_Hs02_00342204 predicted 264
8 SASI_Hs01_00141635 predicted 351
9 SASI_Hs01_00141637 predicted 386
10 SASI_Hs02_00342205 predicted 566
11 SASI_Hs01_00141632 predicted 527
12 SASI_Hs01_00141636 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013162 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260976 predicted 648
2 SASI_Rn02_00260977 predicted 306
3 SASI_Rn02_00260978 predicted 598
4 SASI_Rn02_00260979 predicted 644
5 SASI_Rn02_00260980 predicted 352
6 SASI_Rn02_00260981 predicted 655
7 SASI_Rn02_00260982 predicted 603
8 SASI_Rn02_00260983 predicted 340
9 SASI_Rn02_00260984 predicted 650
10 SASI_Rn02_00260985 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011255 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057267 predicted 864
2 SASI_Mm01_00057268 predicted 387
3 SASI_Mm01_00057269 predicted 933
4 SASI_Mm01_00057271 predicted 430
5 SASI_Mm01_00057272 predicted 908
6 SASI_Mm01_00057273 predicted 612
7 SASI_Mm01_00057274 predicted 510
8 SASI_Mm02_00320260 predicted 542
9 SASI_Mm01_00057275 predicted 848
10 SASI_Mm01_00057276 predicted 737
11 SASI_Mm01_00057270 predicted 419
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011255
VALIDATED
RBP4 MISSION shRNA Bacterial Glycerol Stock
retinol binding protein 4, plasma
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011255.2-863s1c1
Sequence:CCGGGATGGATCGAACACAATGGTTCTCGAGAACCATTGTGTTCGATCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011255.2-504s1c1
Sequence:CCGGTGTGGACGAGAAGGGTCATATCTCGAGATATGACCCTTCTCGTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011255.3-447s21c1
Sequence:CCGGCGACACGGACTACGACACCTTCTCGAGAAGGTGTCGTAGTCCGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011255.2-687s1c1
Sequence:CCGGCGACACGGACTACGACACCTTCTCGAGAAGGTGTCGTAGTCCGTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011255.2-405s1c1
Sequence:CCGGGAACTTCGACAAGGCTCGTTTCTCGAGAAACGAGCCTTGTCGAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011255.2-964s1c1
Sequence:CCGGCCGGTCTTCATCTCTATTTATCTCGAGATAAATAGAGATGAAGACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011255.3-240s21c1
Sequence:CCGGAGACAACATCATCGCTGAGTTCTCGAGAACTCAGCGATGATGTTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011255.3-165s21c1
Sequence:CCGGGAACTTCGACAAGGCTCGTTTCTCGAGAAACGAGCCTTGTCGAAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011255.3-264s21c1
Sequence:CCGGTGTGGACGAGAAGGGTCATATCTCGAGATATGACCCTTCTCGTCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011255.3-724s21c1
Sequence:CCGGCCGGTCTTCATCTCTATTTATCTCGAGATAAATAGAGATGAAGACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011255.3-625s21c1
Sequence:CCGGTGGATTGAACACAATGGTTACCTCGAGGTAACCATTGTGTTCAATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011255
VALIDATED
RBP4 MISSION shRNA shRNA Plasmid DNA
retinol binding protein 4, plasma
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011255.2-863s1c1
Sequence:CCGGGATGGATCGAACACAATGGTTCTCGAGAACCATTGTGTTCGATCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011255.2-504s1c1
Sequence:CCGGTGTGGACGAGAAGGGTCATATCTCGAGATATGACCCTTCTCGTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011255.3-447s21c1
Sequence:CCGGCGACACGGACTACGACACCTTCTCGAGAAGGTGTCGTAGTCCGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011255.2-687s1c1
Sequence:CCGGCGACACGGACTACGACACCTTCTCGAGAAGGTGTCGTAGTCCGTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011255.2-405s1c1
Sequence:CCGGGAACTTCGACAAGGCTCGTTTCTCGAGAAACGAGCCTTGTCGAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011255.2-964s1c1
Sequence:CCGGCCGGTCTTCATCTCTATTTATCTCGAGATAAATAGAGATGAAGACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011255.3-240s21c1
Sequence:CCGGAGACAACATCATCGCTGAGTTCTCGAGAACTCAGCGATGATGTTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011255.3-165s21c1
Sequence:CCGGGAACTTCGACAAGGCTCGTTTCTCGAGAAACGAGCCTTGTCGAAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011255.3-264s21c1
Sequence:CCGGTGTGGACGAGAAGGGTCATATCTCGAGATATGACCCTTCTCGTCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011255.3-724s21c1
Sequence:CCGGCCGGTCTTCATCTCTATTTATCTCGAGATAAATAGAGATGAAGACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011255.3-625s21c1
Sequence:CCGGTGGATTGAACACAATGGTTACCTCGAGGTAACCATTGTGTTCAATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011255
VALIDATED
RBP4 MISSION shRNA Lentiviral Transduction Particles
retinol binding protein 4, plasma
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011255.2-863s1c1
Sequence:CCGGGATGGATCGAACACAATGGTTCTCGAGAACCATTGTGTTCGATCCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011255.2-504s1c1
Sequence:CCGGTGTGGACGAGAAGGGTCATATCTCGAGATATGACCCTTCTCGTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011255.3-447s21c1
Sequence:CCGGCGACACGGACTACGACACCTTCTCGAGAAGGTGTCGTAGTCCGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011255.2-687s1c1
Sequence:CCGGCGACACGGACTACGACACCTTCTCGAGAAGGTGTCGTAGTCCGTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011255.2-405s1c1
Sequence:CCGGGAACTTCGACAAGGCTCGTTTCTCGAGAAACGAGCCTTGTCGAAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105630    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011255.2-964s1c1
Sequence:CCGGCCGGTCTTCATCTCTATTTATCTCGAGATAAATAGAGATGAAGACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011255.3-240s21c1
Sequence:CCGGAGACAACATCATCGCTGAGTTCTCGAGAACTCAGCGATGATGTTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011255.3-165s21c1
Sequence:CCGGGAACTTCGACAAGGCTCGTTTCTCGAGAAACGAGCCTTGTCGAAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011255.3-264s21c1
Sequence:CCGGTGTGGACGAGAAGGGTCATATCTCGAGATATGACCCTTCTCGTCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363696    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011255.3-724s21c1
Sequence:CCGGCCGGTCTTCATCTCTATTTATCTCGAGATAAATAGAGATGAAGACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377022    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011255.3-625s21c1
Sequence:CCGGTGGATTGAACACAATGGTTACCTCGAGGTAACCATTGTGTTCAATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006744
RBP4 MISSION shRNA Bacterial Glycerol Stock
retinol binding protein 4, plasma
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006744.2-526s1c1
Sequence:CCGGTGACAGCTACTCCTTCGTGTTCTCGAGAACACGAAGGAGTAGCTGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006744.3-691s21c1
Sequence:CCGGCAATATCAAGAATCTAGTTTCCTCGAGGAAACTAGATTCTTGATATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006744.2-166s1c1
Sequence:CCGGAGTCAAGGAGAACTTCGACAACTCGAGTTGTCGAAGTTCTCCTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006744.2-382s1c1
Sequence:CCGGCCCTGCCAAGTTCAAGATGAACTCGAGTTCATCTTGAACTTGGCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006744.2-458s1c1
Sequence:CCGGGACACAGACTACGACACGTATCTCGAGATACGTGTCGTAGTCTGTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006744.2-663s1c1
Sequence:CCGGGCAGATCAGAAAGAAACCTTTCTCGAGAAAGGTTTCTTTCTGATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006744.3-734s21c1
Sequence:CCGGCTCAGTCTTCAGCTCTATTTACTCGAGTAAATAGAGCTGAAGACTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006744.3-576s21c1
Sequence:CCGGAGAAGCGCAGAAGATTGTAAGCTCGAGCTTACAATCTTCTGCGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006744
RBP4 MISSION shRNA shRNA Plasmid DNA
retinol binding protein 4, plasma
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006744.2-526s1c1
Sequence:CCGGTGACAGCTACTCCTTCGTGTTCTCGAGAACACGAAGGAGTAGCTGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006744.3-691s21c1
Sequence:CCGGCAATATCAAGAATCTAGTTTCCTCGAGGAAACTAGATTCTTGATATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006744.2-166s1c1
Sequence:CCGGAGTCAAGGAGAACTTCGACAACTCGAGTTGTCGAAGTTCTCCTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006744.2-382s1c1
Sequence:CCGGCCCTGCCAAGTTCAAGATGAACTCGAGTTCATCTTGAACTTGGCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006744.2-458s1c1
Sequence:CCGGGACACAGACTACGACACGTATCTCGAGATACGTGTCGTAGTCTGTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006744.2-663s1c1
Sequence:CCGGGCAGATCAGAAAGAAACCTTTCTCGAGAAAGGTTTCTTTCTGATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006744.3-734s21c1
Sequence:CCGGCTCAGTCTTCAGCTCTATTTACTCGAGTAAATAGAGCTGAAGACTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006744.3-576s21c1
Sequence:CCGGAGAAGCGCAGAAGATTGTAAGCTCGAGCTTACAATCTTCTGCGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006744
RBP4 MISSION shRNA Lentiviral Transduction Particles
retinol binding protein 4, plasma
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006744.2-526s1c1
Sequence:CCGGTGACAGCTACTCCTTCGTGTTCTCGAGAACACGAAGGAGTAGCTGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373362    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006744.3-691s21c1
Sequence:CCGGCAATATCAAGAATCTAGTTTCCTCGAGGAAACTAGATTCTTGATATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006744.2-166s1c1
Sequence:CCGGAGTCAAGGAGAACTTCGACAACTCGAGTTGTCGAAGTTCTCCTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006744.2-382s1c1
Sequence:CCGGCCCTGCCAAGTTCAAGATGAACTCGAGTTCATCTTGAACTTGGCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006744.2-458s1c1
Sequence:CCGGGACACAGACTACGACACGTATCTCGAGATACGTGTCGTAGTCTGTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006744.2-663s1c1
Sequence:CCGGGCAGATCAGAAAGAAACCTTTCTCGAGAAAGGTTTCTTTCTGATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373363    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006744.3-734s21c1
Sequence:CCGGCTCAGTCTTCAGCTCTATTTACTCGAGTAAATAGAGCTGAAGACTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006744.3-576s21c1
Sequence:CCGGAGAAGCGCAGAAGATTGTAAGCTCGAGCTTACAATCTTCTGCGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)