EMAIL THIS PAGE TO A FRIEND

RBPJ

recombination signal binding protein for immunoglobulin kappa J region

153 Gene Product Result for
Synonyms: AOS3 CBF1 IGKJRB IGKJRB1 KBF2 RBP-J RBPJK RBPSUH SUH csl
UniProtKB ID: Q06330, B4DY22, Q5XKH9, Q6P1N3
Gene ID:
Human(3516) Summary: The protein encoded by this gene is a transcriptional regulator important in the Notch signaling pathway. The encoded protein acts as a repressor when not bound to Notch proteins and an activator when bound to Notch proteins. It is thought to function by recruiting chromatin remodeling complexes containing histone deacetylase or histone acetylase proteins to Notch signaling pathway genes. Also, this protein can bind specifically to the recombination signal sequence of immunglobulin kappa type J segments. Several transcript variants encoding different isoforms have been found for this gene, and several pseudogenes of this gene exist on chromosome 9. [provided by RefSeq, Oct 2011]
Mouse(19664) recombination signal binding protein for immunoglobulin kappa J region
Rat(679028) recombination signal binding protein for immunoglobulin kappa J region
chicken(422802) recombination signal binding protein for immunoglobulin kappa J region
Horse(100055547) recombination signal binding protein for immunoglobulin kappa J region
domestic cat(101100207) recombination signal binding protein for immunoglobulin kappa J region
dog(479122) recombination signal binding protein for immunoglobulin kappa J region
domestic guinea pig(100716535) recombination signal binding protein for immunoglobulin kappa J region
naked mole-rat(101726624) recombination signal binding protein for immunoglobulin kappa J region
cow(767928) recombination signal binding protein for immunoglobulin kappa J region
sheep(101107196) recombination signal binding protein for immunoglobulin kappa J region
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005349 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005349 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005349 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009035 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009035 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009035 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005349 Rosetta Predictions human pricing
NM_015874 Rosetta Predictions human pricing
NM_203283 Rosetta Predictions human pricing
NM_203284 Rosetta Predictions human pricing
XM_001053717 Rosetta Predictions rat pricing
XM_001053777 Rosetta Predictions rat pricing
XM_001053835 Rosetta Predictions rat pricing
NM_001080927 Rosetta Predictions mouse pricing
NM_001080928 Rosetta Predictions mouse pricing
NM_009035 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005349 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077588 predicted 1332
2 SASI_Hs01_00077589 predicted 841
3 SASI_Hs01_00077590 predicted 836
4 SASI_Hs01_00077591 predicted 823
5 SASI_Hs01_00077592 predicted 1074
6 SASI_Hs01_00077593 predicted 1055
7 SASI_Hs02_00339436 predicted 1109
8 SASI_Hs01_00077594 predicted 797
9 SASI_Hs01_00077596 predicted 1506
10 SASI_Hs01_00077597 predicted 781
11 SASI_Hs01_00077595 predicted 694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119678 predicted 1263
2 SASI_Hs01_00119679 predicted 769
3 SASI_Hs01_00119680 predicted 765
4 SASI_Hs01_00119681 predicted 745
5 SASI_Hs01_00119682 predicted 994
6 SASI_Hs01_00119683 predicted 983
7 SASI_Hs02_00348458 predicted 1028
8 SASI_Hs01_00119684 predicted 725
9 SASI_Hs01_00119686 predicted 1429
10 SASI_Hs01_00119687 predicted 708
11 SASI_Hs01_00119685 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097064 predicted 1220
2 SASI_Hs01_00097065 predicted 721
3 SASI_Hs01_00097066 predicted 720
4 SASI_Hs01_00097067 predicted 706
5 SASI_Hs01_00097068 predicted 955
6 SASI_Hs01_00097069 predicted 944
7 SASI_Hs02_00373183 predicted 984
8 SASI_Hs01_00097070 predicted 681
9 SASI_Hs01_00097072 predicted 1392
10 SASI_Hs01_00097073 predicted 664
11 SASI_Hs01_00097071 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027786 predicted 1439
2 SASI_Hs01_00027787 predicted 955
3 SASI_Hs01_00027788 predicted 947
4 SASI_Hs01_00027789 predicted 933
5 SASI_Hs01_00027790 predicted 1181
6 SASI_Hs01_00027791 predicted 1166
7 SASI_Hs02_00373184 predicted 1214
8 SASI_Hs01_00027792 predicted 906
9 SASI_Hs01_00027794 predicted 1616
10 SASI_Hs01_00027795 predicted 897
11 SASI_Hs01_00027793 predicted 803
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053717 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273340 predicted 909
2 SASI_Rn02_00273341 predicted 552
3 SASI_Rn02_00273342 predicted 1498
4 SASI_Rn02_00273343 predicted 1349
5 SASI_Rn02_00273344 predicted 1591
6 SASI_Rn02_00273345 predicted 1481
7 SASI_Rn02_00273346 predicted 668
8 SASI_Rn02_00273347 predicted 776
9 SASI_Rn02_00273348 predicted 995
10 SASI_Rn02_00273349 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053777 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273522 predicted 830
2 SASI_Rn02_00273523 predicted 469
3 SASI_Rn02_00273524 predicted 1414
4 SASI_Rn02_00273525 predicted 1259
5 SASI_Rn02_00273526 predicted 1515
6 SASI_Rn02_00273527 predicted 1398
7 SASI_Rn02_00273528 predicted 587
8 SASI_Rn02_00273529 predicted 690
9 SASI_Rn02_00273530 predicted 904
10 SASI_Rn02_00273531 predicted 978
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053835 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273754 predicted 994
2 SASI_Rn02_00273755 predicted 636
3 SASI_Rn02_00273756 predicted 1583
4 SASI_Rn02_00273757 predicted 1425
5 SASI_Rn02_00273758 predicted 1675
6 SASI_Rn02_00273759 predicted 1563
7 SASI_Rn02_00273760 predicted 759
8 SASI_Rn02_00273761 predicted 855
9 SASI_Rn02_00273762 predicted 1074
10 SASI_Rn02_00273763 predicted 1136
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080927 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293973 predicted 634
2 SASI_Mm02_00293974 predicted 1189
3 SASI_Mm02_00293975 predicted 926
4 SASI_Mm02_00293976 predicted 1616
5 SASI_Mm02_00293977 predicted 1493
6 SASI_Mm02_00293978 predicted 1498
7 SASI_Mm02_00293979 predicted 1000
8 SASI_Mm02_00293980 predicted 540
9 SASI_Mm02_00293981 predicted 923
10 SASI_Mm02_00293982 predicted 1558
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080928 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00293983 predicted 613
2 SASI_Mm02_00293984 predicted 1165
3 SASI_Mm02_00293985 predicted 898
4 SASI_Mm02_00293986 predicted 1588
5 SASI_Mm02_00293987 predicted 1472
6 SASI_Mm02_00293988 predicted 1466
7 SASI_Mm02_00293989 predicted 977
8 SASI_Mm02_00293990 predicted 515
9 SASI_Mm02_00293991 predicted 895
10 SASI_Mm02_00293992 predicted 1536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009035 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123162 predicted 759
2 SASI_Mm01_00123163 predicted 1305
3 SASI_Mm01_00123164 predicted 1039
4 SASI_Mm02_00315192 predicted 1738
5 SASI_Mm01_00123165 predicted 1618
6 SASI_Mm01_00123167 predicted 1614
7 SASI_Mm01_00123168 predicted 1125
8 SASI_Mm01_00123169 predicted 661
9 SASI_Mm01_00123170 predicted 1047
10 SASI_Mm02_00315193 predicted 1678
11 SASI_Mm01_00123166 predicted 1647
12 SASI_Mm01_00123171 predicted 1655
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005349
RBPJ MISSION shRNA Bacterial Glycerol Stock
recombination signal binding protein for immunoglobulin kappa J region
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005349.2-845s21c1
Sequence:CCGGGCATGTAGAAGGAGGTAATTTCTCGAGAAATTACCTCCTTCTACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005349.2-2109s21c1
Sequence:CCGGATGGACCAAGGAACTTGTATACTCGAGTATACAAGTTCCTTGGTCCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005349.2-2058s1c1
Sequence:CCGGGCTGGAATACAAGTTGAACAACTCGAGTTGTTCAACTTGTATTCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005349.2-1643s1c1
Sequence:CCGGCCCTAACGAATCAAACACAAACTCGAGTTTGTGTTTGATTCGTTAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005349.2-1231s1c1
Sequence:CCGGGCACAGATAAGGCAGAGTATACTCGAGTATACTCTGCCTTATCTGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005349.2-821s1c1
Sequence:CCGGCCAGACAGTTAGTACCAGATACTCGAGTATCTGGTACTAACTGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005349.2-575s1c1
Sequence:CCGGGCAGCTAAACTTGGAAGGAAACTCGAGTTTCCTTCCAAGTTTAGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005349
RBPJ MISSION shRNA shRNA Plasmid DNA
recombination signal binding protein for immunoglobulin kappa J region
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005349.2-845s21c1
Sequence:CCGGGCATGTAGAAGGAGGTAATTTCTCGAGAAATTACCTCCTTCTACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005349.2-2109s21c1
Sequence:CCGGATGGACCAAGGAACTTGTATACTCGAGTATACAAGTTCCTTGGTCCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005349.2-2058s1c1
Sequence:CCGGGCTGGAATACAAGTTGAACAACTCGAGTTGTTCAACTTGTATTCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005349.2-1643s1c1
Sequence:CCGGCCCTAACGAATCAAACACAAACTCGAGTTTGTGTTTGATTCGTTAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005349.2-1231s1c1
Sequence:CCGGGCACAGATAAGGCAGAGTATACTCGAGTATACTCTGCCTTATCTGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005349.2-821s1c1
Sequence:CCGGCCAGACAGTTAGTACCAGATACTCGAGTATCTGGTACTAACTGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005349.2-575s1c1
Sequence:CCGGGCAGCTAAACTTGGAAGGAAACTCGAGTTTCCTTCCAAGTTTAGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005349
RBPJ MISSION shRNA Lentiviral Transduction Particles
recombination signal binding protein for immunoglobulin kappa J region
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005349.2-845s21c1
Sequence:CCGGGCATGTAGAAGGAGGTAATTTCTCGAGAAATTACCTCCTTCTACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005349.2-2109s21c1
Sequence:CCGGATGGACCAAGGAACTTGTATACTCGAGTATACAAGTTCCTTGGTCCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005349.2-2058s1c1
Sequence:CCGGGCTGGAATACAAGTTGAACAACTCGAGTTGTTCAACTTGTATTCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005349.2-1643s1c1
Sequence:CCGGCCCTAACGAATCAAACACAAACTCGAGTTTGTGTTTGATTCGTTAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005349.2-1231s1c1
Sequence:CCGGGCACAGATAAGGCAGAGTATACTCGAGTATACTCTGCCTTATCTGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005349.2-821s1c1
Sequence:CCGGCCAGACAGTTAGTACCAGATACTCGAGTATCTGGTACTAACTGTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005349.2-575s1c1
Sequence:CCGGGCAGCTAAACTTGGAAGGAAACTCGAGTTTCCTTCCAAGTTTAGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009035
VALIDATED
RBPJ MISSION shRNA Bacterial Glycerol Stock
recombination signal binding protein for immunoglobulin kappa J region
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009035.4-798s21c1
Sequence:CCGGCCAGACAGTTAGTACCAGGTACTCGAGTACCTGGTACTAACTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009035.4-3207s21c1
Sequence:CCGGGCAGACTCATTGGGCTACATTCTCGAGAATGTAGCCCAATGAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009035.4-508s21c1
Sequence:CCGGCCCTGTGCGTTTATTGGAATACTCGAGTATTCCAATAAACGCACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009035.4-309s21c1
Sequence:CCGGTAGGGAAGCTATGCGAAATTACTCGAGTAATTTCGCATAGCTTCCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009035.4-1486s21c1
Sequence:CCGGCCAGTGACTTTGGTCCGAAATCTCGAGATTTCGGACCAAAGTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009035.1-3071s1c1
Sequence:CCGGGCAGACTCATTGGGCTACATTCTCGAGAATGTAGCCCAATGAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009035.1-668s1c1
Sequence:CCGGCCAGACAGTTAGTACCAGGTACTCGAGTACCTGGTACTAACTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009035.1-919s1c1
Sequence:CCGGCTGTATCACAACTCCACAAATCTCGAGATTTGTGGAGTTGTGATACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009035.1-378s1c1
Sequence:CCGGCCCTGTGCGTTTATTGGAATACTCGAGTATTCCAATAAACGCACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009035.1-1356s1c1
Sequence:CCGGCCAGTGACTTTGGTCCGAAATCTCGAGATTTCGGACCAAAGTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009035
VALIDATED
RBPJ MISSION shRNA shRNA Plasmid DNA
recombination signal binding protein for immunoglobulin kappa J region
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009035.4-798s21c1
Sequence:CCGGCCAGACAGTTAGTACCAGGTACTCGAGTACCTGGTACTAACTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009035.4-3207s21c1
Sequence:CCGGGCAGACTCATTGGGCTACATTCTCGAGAATGTAGCCCAATGAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009035.4-508s21c1
Sequence:CCGGCCCTGTGCGTTTATTGGAATACTCGAGTATTCCAATAAACGCACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009035.4-309s21c1
Sequence:CCGGTAGGGAAGCTATGCGAAATTACTCGAGTAATTTCGCATAGCTTCCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009035.4-1486s21c1
Sequence:CCGGCCAGTGACTTTGGTCCGAAATCTCGAGATTTCGGACCAAAGTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009035.1-3071s1c1
Sequence:CCGGGCAGACTCATTGGGCTACATTCTCGAGAATGTAGCCCAATGAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009035.1-668s1c1
Sequence:CCGGCCAGACAGTTAGTACCAGGTACTCGAGTACCTGGTACTAACTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009035.1-919s1c1
Sequence:CCGGCTGTATCACAACTCCACAAATCTCGAGATTTGTGGAGTTGTGATACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009035.1-378s1c1
Sequence:CCGGCCCTGTGCGTTTATTGGAATACTCGAGTATTCCAATAAACGCACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009035.1-1356s1c1
Sequence:CCGGCCAGTGACTTTGGTCCGAAATCTCGAGATTTCGGACCAAAGTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009035
VALIDATED
RBPJ MISSION shRNA Lentiviral Transduction Particles
recombination signal binding protein for immunoglobulin kappa J region
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009035.4-798s21c1
Sequence:CCGGCCAGACAGTTAGTACCAGGTACTCGAGTACCTGGTACTAACTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353944    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009035.4-3207s21c1
Sequence:CCGGGCAGACTCATTGGGCTACATTCTCGAGAATGTAGCCCAATGAGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009035.4-508s21c1
Sequence:CCGGCCCTGTGCGTTTATTGGAATACTCGAGTATTCCAATAAACGCACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009035.4-309s21c1
Sequence:CCGGTAGGGAAGCTATGCGAAATTACTCGAGTAATTTCGCATAGCTTCCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009035.4-1486s21c1
Sequence:CCGGCCAGTGACTTTGGTCCGAAATCTCGAGATTTCGGACCAAAGTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097284    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009035.1-3071s1c1
Sequence:CCGGGCAGACTCATTGGGCTACATTCTCGAGAATGTAGCCCAATGAGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009035.1-668s1c1
Sequence:CCGGCCAGACAGTTAGTACCAGGTACTCGAGTACCTGGTACTAACTGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009035.1-919s1c1
Sequence:CCGGCTGTATCACAACTCCACAAATCTCGAGATTTGTGGAGTTGTGATACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009035.1-378s1c1
Sequence:CCGGCCCTGTGCGTTTATTGGAATACTCGAGTATTCCAATAAACGCACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009035.1-1356s1c1
Sequence:CCGGCCAGTGACTTTGGTCCGAAATCTCGAGATTTCGGACCAAAGTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)