EMAIL THIS PAGE TO A FRIEND

RBPMS2

RNA binding protein with multiple splicing 2

94 Gene Product Result for
UniProtKB ID: Q6ZRY4
Gene ID:
Mouse(71973) RNA binding protein with multiple splicing 2
Rat(503214) RNA binding protein with multiple splicing 2
chicken(395678) RNA binding protein with multiple splicing 2
dog(610746) RNA binding protein with multiple splicing 2
Horse(100066725) RNA binding protein with multiple splicing 2
domestic cat(101097732) RNA binding protein with multiple splicing 2
cow(518188) RNA binding protein with multiple splicing 2
sheep(101122793) RNA binding protein with multiple splicing 2
naked mole-rat(101700812) RNA binding protein with multiple splicing 2
domestic guinea pig(100724533) RNA binding protein with multiple splicing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194272 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194272 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194272 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028030 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028030 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028030 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_194272 Rosetta Predictions human pricing
XM_001076681 Rosetta Predictions rat pricing
XM_578738 Rosetta Predictions rat pricing
NM_028030 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128391 predicted 1235
2 SASI_Hs01_00128392 predicted 536
3 SASI_Hs02_00371385 predicted 1063
4 SASI_Hs01_00128393 predicted 1248
5 SASI_Hs01_00128394 predicted 512
6 SASI_Hs01_00128395 predicted 593
7 SASI_Hs01_00128396 predicted 542
8 SASI_Hs01_00128397 predicted 512
9 SASI_Hs01_00128398 predicted 510
10 SASI_Hs01_00128399 predicted 989
11 SASI_Hs01_00128400 predicted 1204
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076681 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354130 predicted 586
2 SASI_Rn02_00354131 predicted 552
3 SASI_Rn02_00354132 predicted 1067
4 SASI_Rn02_00354133 predicted 808
5 SASI_Rn02_00354134 predicted 300
6 SASI_Rn02_00354135 predicted 801
7 SASI_Rn02_00354136 predicted 817
8 SASI_Rn02_00354137 predicted 563
9 SASI_Rn02_00354138 predicted 413
10 SASI_Rn02_00354139 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578738 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408276 predicted 1184
2 SASI_Rn02_00408277 predicted 778
3 SASI_Rn02_00408278 predicted 843
4 SASI_Rn02_00408279 predicted 828
5 SASI_Rn02_00408280 predicted 1437
6 SASI_Rn02_00408281 predicted 885
7 SASI_Rn02_00408282 predicted 933
8 SASI_Rn02_00408283 predicted 685
9 SASI_Rn02_00408284 predicted 1432
10 SASI_Rn02_00408285 predicted 1189
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028030 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113076 predicted 480
2 SASI_Mm01_00113075 predicted 1201
3 SASI_Mm02_00333173 predicted 580
4 SASI_Mm01_00113077 predicted 704
5 SASI_Mm01_00113078 predicted 975
6 SASI_Mm01_00113079 predicted 1167
7 SASI_Mm01_00113080 predicted 1216
8 SASI_Mm01_00113081 predicted 734
9 SASI_Mm01_00113082 predicted 1178
10 SASI_Mm01_00113084 predicted 572
11 SASI_Mm01_00113083 predicted 1345
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194272
RBPMS2 MISSION shRNA Bacterial Glycerol Stock
RNA binding protein with multiple splicing 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194272.1-506s21c1
Sequence:CCGGAGAATGCGCTGAACGGTATTCCTCGAGGAATACCGTTCAGCGCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194272.1-1208s1c1
Sequence:CCGGCGAGGAAGTGAGGTGTTTAATCTCGAGATTAAACACCTCACTTCCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194272.1-1713s1c1
Sequence:CCGGGCCCTGTCAGATAAGTTTAATCTCGAGATTAAACTTATCTGACAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194272.1-361s21c1
Sequence:CCGGGGCCTCCCTGTGGACATTAAACTCGAGTTTAATGTCCACAGGGAGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194272.1-1673s21c1
Sequence:CCGGTTTCATGTGCGTACCATTAATCTCGAGATTAATGGTACGCACATGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194272.1-861s1c1
Sequence:CCGGGAAGTACCGTCAGTTCTGTTACTCGAGTAACAGAACTGACGGTACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194272.1-1785s1c1
Sequence:CCGGCCTTTGTGTCTGGCATTTGTTCTCGAGAACAAATGCCAGACACAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194272.1-599s21c1
Sequence:CCGGAGCTAATGGCAACTCCAAATCCTCGAGGATTTGGAGTTGCCATTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194272
RBPMS2 MISSION shRNA shRNA Plasmid DNA
RNA binding protein with multiple splicing 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194272.1-506s21c1
Sequence:CCGGAGAATGCGCTGAACGGTATTCCTCGAGGAATACCGTTCAGCGCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194272.1-1208s1c1
Sequence:CCGGCGAGGAAGTGAGGTGTTTAATCTCGAGATTAAACACCTCACTTCCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194272.1-1713s1c1
Sequence:CCGGGCCCTGTCAGATAAGTTTAATCTCGAGATTAAACTTATCTGACAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194272.1-361s21c1
Sequence:CCGGGGCCTCCCTGTGGACATTAAACTCGAGTTTAATGTCCACAGGGAGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194272.1-1673s21c1
Sequence:CCGGTTTCATGTGCGTACCATTAATCTCGAGATTAATGGTACGCACATGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194272.1-861s1c1
Sequence:CCGGGAAGTACCGTCAGTTCTGTTACTCGAGTAACAGAACTGACGGTACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194272.1-1785s1c1
Sequence:CCGGCCTTTGTGTCTGGCATTTGTTCTCGAGAACAAATGCCAGACACAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194272.1-599s21c1
Sequence:CCGGAGCTAATGGCAACTCCAAATCCTCGAGGATTTGGAGTTGCCATTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194272
RBPMS2 MISSION shRNA Lentiviral Transduction Particles
RNA binding protein with multiple splicing 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194272.1-506s21c1
Sequence:CCGGAGAATGCGCTGAACGGTATTCCTCGAGGAATACCGTTCAGCGCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194272.1-1208s1c1
Sequence:CCGGCGAGGAAGTGAGGTGTTTAATCTCGAGATTAAACACCTCACTTCCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167872    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194272.1-1713s1c1
Sequence:CCGGGCCCTGTCAGATAAGTTTAATCTCGAGATTAAACTTATCTGACAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257188    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194272.1-361s21c1
Sequence:CCGGGGCCTCCCTGTGGACATTAAACTCGAGTTTAATGTCCACAGGGAGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194272.1-1673s21c1
Sequence:CCGGTTTCATGTGCGTACCATTAATCTCGAGATTAATGGTACGCACATGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194272.1-861s1c1
Sequence:CCGGGAAGTACCGTCAGTTCTGTTACTCGAGTAACAGAACTGACGGTACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194272.1-1785s1c1
Sequence:CCGGCCTTTGTGTCTGGCATTTGTTCTCGAGAACAAATGCCAGACACAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_194272.1-599s21c1
Sequence:CCGGAGCTAATGGCAACTCCAAATCCTCGAGGATTTGGAGTTGCCATTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028030
VALIDATED
RBPMS2 MISSION shRNA Bacterial Glycerol Stock
RNA binding protein with multiple splicing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028030.3-312s21c1
Sequence:CCGGAGGAGGTCCGCACACTGTTTGCTCGAGCAAACAGTGTGCGGACCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028030.3-399s21c1
Sequence:CCGGATGAAGGGTCCCTGATCAAGCCTCGAGGCTTGATCAGGGACCCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028030.2-571s1c1
Sequence:CCGGGCAAACTAATAGCGACACCAACTCGAGTTGGTGTCGCTATTAGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028030.2-345s1c1
Sequence:CCGGGTGGATATTAAACCTAGAGAACTCGAGTTCTCTAGGTTTAATATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181706    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028030.2-1816s1c1
Sequence:CCGGGCATGTCTGTGCTTTACCTTTCTCGAGAAAGGTAAAGCACAGACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028030.2-381s1c1
Sequence:CCGGCGTCCATTCAAGGGCTATGAACTCGAGTTCATAGCCCTTGAATGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028030.3-347s21c1
Sequence:CCGGGTGGATATTAAACCTAGAGAACTCGAGTTCTCTAGGTTTAATATCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340422    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028030.3-1818s21c1
Sequence:CCGGGCATGTCTGTGCTTTACCTTTCTCGAGAAAGGTAAAGCACAGACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028030.3-370s21c1
Sequence:CCGGCTACCTGCTCTTCCGTCCATTCTCGAGAATGGACGGAAGAGCAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028030
VALIDATED
RBPMS2 MISSION shRNA shRNA Plasmid DNA
RNA binding protein with multiple splicing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028030.3-312s21c1
Sequence:CCGGAGGAGGTCCGCACACTGTTTGCTCGAGCAAACAGTGTGCGGACCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028030.3-399s21c1
Sequence:CCGGATGAAGGGTCCCTGATCAAGCCTCGAGGCTTGATCAGGGACCCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028030.2-571s1c1
Sequence:CCGGGCAAACTAATAGCGACACCAACTCGAGTTGGTGTCGCTATTAGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028030.2-345s1c1
Sequence:CCGGGTGGATATTAAACCTAGAGAACTCGAGTTCTCTAGGTTTAATATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181706    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028030.2-1816s1c1
Sequence:CCGGGCATGTCTGTGCTTTACCTTTCTCGAGAAAGGTAAAGCACAGACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028030.2-381s1c1
Sequence:CCGGCGTCCATTCAAGGGCTATGAACTCGAGTTCATAGCCCTTGAATGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028030.3-347s21c1
Sequence:CCGGGTGGATATTAAACCTAGAGAACTCGAGTTCTCTAGGTTTAATATCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340422    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028030.3-1818s21c1
Sequence:CCGGGCATGTCTGTGCTTTACCTTTCTCGAGAAAGGTAAAGCACAGACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000340423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028030.3-370s21c1
Sequence:CCGGCTACCTGCTCTTCCGTCCATTCTCGAGAATGGACGGAAGAGCAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028030
VALIDATED
RBPMS2 MISSION shRNA Lentiviral Transduction Particles
RNA binding protein with multiple splicing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028030.3-312s21c1
Sequence:CCGGAGGAGGTCCGCACACTGTTTGCTCGAGCAAACAGTGTGCGGACCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028030.3-399s21c1
Sequence:CCGGATGAAGGGTCCCTGATCAAGCCTCGAGGCTTGATCAGGGACCCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028030.2-571s1c1
Sequence:CCGGGCAAACTAATAGCGACACCAACTCGAGTTGGTGTCGCTATTAGTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028030.2-345s1c1
Sequence:CCGGGTGGATATTAAACCTAGAGAACTCGAGTTCTCTAGGTTTAATATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181706    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028030.2-1816s1c1
Sequence:CCGGGCATGTCTGTGCTTTACCTTTCTCGAGAAAGGTAAAGCACAGACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028030.2-381s1c1
Sequence:CCGGCGTCCATTCAAGGGCTATGAACTCGAGTTCATAGCCCTTGAATGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028030.3-347s21c1
Sequence:CCGGGTGGATATTAAACCTAGAGAACTCGAGTTCTCTAGGTTTAATATCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340422    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028030.3-1818s21c1
Sequence:CCGGGCATGTCTGTGCTTTACCTTTCTCGAGAAAGGTAAAGCACAGACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000340423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028030.3-370s21c1
Sequence:CCGGCTACCTGCTCTTCCGTCCATTCTCGAGAATGGACGGAAGAGCAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)