EMAIL THIS PAGE TO A FRIEND

RBPMS

RNA binding protein with multiple splicing

208 Gene Product Result for
Synonyms: HERMES
UniProtKB ID: Q93062, D3DSU9, Q92516, Q92517, Q92518, Q96J26
Gene ID:
Human(11030) Summary: This gene encodes a member of the RNA recognition motif family of RNA-binding proteins. The RNA recognition motif is between 80-100 amino acids in length and family members contain one to four copies of the motif. The RNA recognition motif consists of two short stretches of conserved sequence, as well as a few highly conserved hydrophobic residues. The encoded protein has a single, putative RNA recognition motif in its N-terminus. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
Mouse(19663) RNA binding protein gene with multiple splicing
Rat(498642) RNA binding protein with multiple splicing
chicken(428738) RNA binding protein with multiple splicing
dog(475599) RNA binding protein with multiple splicing
domestic cat(101089852) RNA binding protein with multiple splicing
naked mole-rat(101723220) RNA binding protein with multiple splicing
cow(614417) RNA binding protein with multiple splicing
sheep(101105052) RNA binding protein with multiple splicing
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006867 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006867 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006867 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019733 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019733 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019733 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU086751 MISSION® esiRNA esiRNA targeting mouse Rbpms (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008710 Rosetta Predictions human pricing
NM_001008711 Rosetta Predictions human pricing
NM_001008712 Rosetta Predictions human pricing
NM_006867 Rosetta Predictions human pricing
XM_001059462 Rosetta Predictions rat pricing
XM_001059526 Rosetta Predictions rat pricing
XM_001059578 Rosetta Predictions rat pricing
XM_573923 Rosetta Predictions rat pricing
NM_001042674 Rosetta Predictions mouse pricing
NM_001042675 Rosetta Predictions mouse pricing
NM_019733 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024546 predicted 807
2 SASI_Hs01_00024547 predicted 801
3 SASI_Hs01_00024548 predicted 889
4 SASI_Hs02_00305538 predicted 938
5 SASI_Hs01_00024549 predicted 897
6 SASI_Hs01_00024550 predicted 824
7 SASI_Hs01_00024552 predicted 809
8 SASI_Hs01_00024553 predicted 940
9 SASI_Hs01_00024554 predicted 909
10 SASI_Hs01_00024555 predicted 902
11 SASI_Hs01_00024551 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008711 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017894 predicted 808
2 SASI_Hs01_00017895 predicted 809
3 SASI_Hs01_00017896 predicted 885
4 SASI_Hs02_00305539 predicted 930
5 SASI_Hs01_00017897 predicted 897
6 SASI_Hs01_00017898 predicted 815
7 SASI_Hs01_00017900 predicted 809
8 SASI_Hs01_00017901 predicted 935
9 SASI_Hs01_00017902 predicted 915
10 SASI_Hs01_00017903 predicted 907
11 SASI_Hs01_00017899 predicted 963
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008712 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071103 predicted 802
2 SASI_Hs01_00071104 predicted 809
3 SASI_Hs01_00071105 predicted 881
4 SASI_Hs02_00305540 predicted 934
5 SASI_Hs01_00071106 predicted 898
6 SASI_Hs01_00071107 predicted 817
7 SASI_Hs01_00071109 predicted 809
8 SASI_Hs01_00071110 predicted 937
9 SASI_Hs01_00071111 predicted 915
10 SASI_Hs01_00071112 predicted 905
11 SASI_Hs01_00071108 predicted 971
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006867 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143310 predicted 802
2 SASI_Hs01_00143311 predicted 809
3 SASI_Hs01_00143312 predicted 888
4 SASI_Hs02_00342500 predicted 935
5 SASI_Hs01_00143313 predicted 897
6 SASI_Hs01_00143314 predicted 817
7 SASI_Hs01_00143316 predicted 800
8 SASI_Hs01_00143317 predicted 937
9 SASI_Hs01_00143318 predicted 908
10 SASI_Hs01_00143319 predicted 910
11 SASI_Hs01_00143315 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059462 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293295 predicted 404
2 SASI_Rn02_00293296 predicted 873
3 SASI_Rn02_00293297 predicted 644
4 SASI_Rn02_00293298 predicted 615
5 SASI_Rn02_00293299 predicted 658
6 SASI_Rn02_00293300 predicted 464
7 SASI_Rn02_00293301 predicted 524
8 SASI_Rn02_00293302 predicted 749
9 SASI_Rn02_00293303 predicted 484
10 SASI_Rn02_00293304 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293509 predicted 402
2 SASI_Rn02_00293510 predicted 400
3 SASI_Rn02_00293511 predicted 1266
4 SASI_Rn02_00293512 predicted 1201
5 SASI_Rn02_00293513 predicted 615
6 SASI_Rn02_00293514 predicted 560
7 SASI_Rn02_00293515 predicted 1161
8 SASI_Rn02_00293516 predicted 469
9 SASI_Rn02_00293517 predicted 529
10 SASI_Rn02_00293518 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059578 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293674 predicted 405
2 SASI_Rn02_00293675 predicted 399
3 SASI_Rn02_00293676 predicted 650
4 SASI_Rn02_00293677 predicted 616
5 SASI_Rn02_00293678 predicted 653
6 SASI_Rn02_00293679 predicted 773
7 SASI_Rn02_00293680 predicted 464
8 SASI_Rn02_00293681 predicted 529
9 SASI_Rn02_00293682 predicted 749
10 SASI_Rn02_00293683 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573923 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401041 predicted 404
2 SASI_Rn02_00401042 predicted 409
3 SASI_Rn02_00401043 predicted 1278
4 SASI_Rn02_00401044 predicted 1206
5 SASI_Rn02_00401045 predicted 619
6 SASI_Rn02_00401046 predicted 1167
7 SASI_Rn02_00401047 predicted 471
8 SASI_Rn02_00401048 predicted 536
9 SASI_Rn02_00401049 predicted 1318
10 SASI_Rn02_00401050 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042674 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290935 predicted 565
2 SASI_Mm02_00290936 predicted 437
3 SASI_Mm02_00290937 predicted 440
4 SASI_Mm02_00290938 predicted 371
5 SASI_Mm02_00290939 predicted 537
6 SASI_Mm02_00290940 predicted 597
7 SASI_Mm02_00290941 predicted 522
8 SASI_Mm02_00290942 predicted 569
9 SASI_Mm02_00290943 predicted 570
10 SASI_Mm02_00290944 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042675 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00290945 predicted 572
2 SASI_Mm02_00290946 predicted 438
3 SASI_Mm02_00290947 predicted 439
4 SASI_Mm02_00290948 predicted 362
5 SASI_Mm02_00290949 predicted 538
6 SASI_Mm02_00290950 predicted 596
7 SASI_Mm02_00290951 predicted 518
8 SASI_Mm02_00290952 predicted 568
9 SASI_Mm02_00290953 predicted 573
10 SASI_Mm02_00290954 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324874 predicted 572
2 SASI_Mm01_00155313 predicted 442
3 SASI_Mm01_00155314 predicted 436
4 SASI_Mm01_00155316 predicted 371
5 SASI_Mm01_00155318 predicted 536
6 SASI_Mm01_00155320 predicted 599
7 SASI_Mm01_00155321 predicted 525
8 SASI_Mm02_00324875 predicted 566
9 SASI_Mm02_00324876 predicted 570
10 SASI_Mm02_00324877 predicted 443
11 SASI_Mm01_00155315 predicted 677
12 SASI_Mm01_00155317 predicted 642
13 SASI_Mm01_00155319 predicted 684
14 SASI_Mm01_00155322 predicted 493
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006867
RBPMS MISSION shRNA Bacterial Glycerol Stock
RNA binding protein with multiple splicing
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006867.2-1062s21c1
Sequence:CCGGTATGAGCTCACAGTGCCTGCACTCGAGTGCAGGCACTGTGAGCTCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006867.2-915s21c1
Sequence:CCGGATCCGCTTCGATCCTGAAATTCTCGAGAATTTCAGGATCGAAGCGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006867.2-769s21c1
Sequence:CCGGTCAAACCTCGGGAGCTCTATCCTCGAGGATAGAGCTCCCGAGGTTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006867.2-727s21c1
Sequence:CCGGAGGAGGTCCGGACCCTATTTGCTCGAGCAAATAGGGTCCGGACCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006867.2-798s21c1
Sequence:CCGGAGACCATTTAAGGGCTATGAGCTCGAGCTCATAGCCCTTAAATGGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006867.2-1239s21c1
Sequence:CCGGTCCCGTCAGTTCTGCTGAATACTCGAGTATTCAGCAGAACTGACGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006867.2-1336s21c1
Sequence:CCGGATCCGAATAAGATCCGAATAACTCGAGTTATTCGGATCTTATTCGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-883s1c1
Sequence:CCGGCCAAGAACAAACTCGTAGGGACTCGAGTCCCTACGAGTTTGTTCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-861s1c1
Sequence:CCGGGCTAAGGCAAACACGAAGATGCTCGAGCATCTTCGTGTTTGCCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-792s1c1
Sequence:CCGGGCTGCAAAGAATGCTTTGAATCTCGAGATTCAAAGCATTCTTTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-721s1c1
Sequence:CCGGGTTCTCTTATAAAGCTCACATCTCGAGATGTGAGCTTTATAAGAGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-857s1c1
Sequence:CCGGGTTTGCTAAGGCAAACACGAACTCGAGTTCGTGTTTGCCTTAGCAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-739s1c1
Sequence:CCGGCATCTAAACAGCCTGTAGGTTCTCGAGAACCTACAGGCTGTTTAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-929s1c1
Sequence:CCGGCAACACTGTACCTCAGTTCATCTCGAGATGAACTGAGGTACAGTGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-849s1c1
Sequence:CCGGCGACTAGAGTTTGCTAAGGCACTCGAGTGCCTTAGCAAACTCTAGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-734s1c1
Sequence:CCGGGCTCACATCTAAACAGCCTGTCTCGAGACAGGCTGTTTAGATGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006867
RBPMS MISSION shRNA shRNA Plasmid DNA
RNA binding protein with multiple splicing
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006867.2-1062s21c1
Sequence:CCGGTATGAGCTCACAGTGCCTGCACTCGAGTGCAGGCACTGTGAGCTCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006867.2-915s21c1
Sequence:CCGGATCCGCTTCGATCCTGAAATTCTCGAGAATTTCAGGATCGAAGCGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006867.2-769s21c1
Sequence:CCGGTCAAACCTCGGGAGCTCTATCCTCGAGGATAGAGCTCCCGAGGTTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006867.2-727s21c1
Sequence:CCGGAGGAGGTCCGGACCCTATTTGCTCGAGCAAATAGGGTCCGGACCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006867.2-798s21c1
Sequence:CCGGAGACCATTTAAGGGCTATGAGCTCGAGCTCATAGCCCTTAAATGGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006867.2-1239s21c1
Sequence:CCGGTCCCGTCAGTTCTGCTGAATACTCGAGTATTCAGCAGAACTGACGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006867.2-1336s21c1
Sequence:CCGGATCCGAATAAGATCCGAATAACTCGAGTTATTCGGATCTTATTCGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-883s1c1
Sequence:CCGGCCAAGAACAAACTCGTAGGGACTCGAGTCCCTACGAGTTTGTTCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-861s1c1
Sequence:CCGGGCTAAGGCAAACACGAAGATGCTCGAGCATCTTCGTGTTTGCCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-792s1c1
Sequence:CCGGGCTGCAAAGAATGCTTTGAATCTCGAGATTCAAAGCATTCTTTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-721s1c1
Sequence:CCGGGTTCTCTTATAAAGCTCACATCTCGAGATGTGAGCTTTATAAGAGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-857s1c1
Sequence:CCGGGTTTGCTAAGGCAAACACGAACTCGAGTTCGTGTTTGCCTTAGCAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-739s1c1
Sequence:CCGGCATCTAAACAGCCTGTAGGTTCTCGAGAACCTACAGGCTGTTTAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-929s1c1
Sequence:CCGGCAACACTGTACCTCAGTTCATCTCGAGATGAACTGAGGTACAGTGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-849s1c1
Sequence:CCGGCGACTAGAGTTTGCTAAGGCACTCGAGTGCCTTAGCAAACTCTAGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-734s1c1
Sequence:CCGGGCTCACATCTAAACAGCCTGTCTCGAGACAGGCTGTTTAGATGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006867
RBPMS MISSION shRNA Lentiviral Transduction Particles
RNA binding protein with multiple splicing
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006867.2-1062s21c1
Sequence:CCGGTATGAGCTCACAGTGCCTGCACTCGAGTGCAGGCACTGTGAGCTCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006867.2-915s21c1
Sequence:CCGGATCCGCTTCGATCCTGAAATTCTCGAGAATTTCAGGATCGAAGCGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006867.2-769s21c1
Sequence:CCGGTCAAACCTCGGGAGCTCTATCCTCGAGGATAGAGCTCCCGAGGTTTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413857    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006867.2-727s21c1
Sequence:CCGGAGGAGGTCCGGACCCTATTTGCTCGAGCAAATAGGGTCCGGACCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006867.2-798s21c1
Sequence:CCGGAGACCATTTAAGGGCTATGAGCTCGAGCTCATAGCCCTTAAATGGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006867.2-1239s21c1
Sequence:CCGGTCCCGTCAGTTCTGCTGAATACTCGAGTATTCAGCAGAACTGACGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425580    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006867.2-1336s21c1
Sequence:CCGGATCCGAATAAGATCCGAATAACTCGAGTTATTCGGATCTTATTCGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-883s1c1
Sequence:CCGGCCAAGAACAAACTCGTAGGGACTCGAGTCCCTACGAGTTTGTTCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-861s1c1
Sequence:CCGGGCTAAGGCAAACACGAAGATGCTCGAGCATCTTCGTGTTTGCCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-792s1c1
Sequence:CCGGGCTGCAAAGAATGCTTTGAATCTCGAGATTCAAAGCATTCTTTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159157    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-721s1c1
Sequence:CCGGGTTCTCTTATAAAGCTCACATCTCGAGATGTGAGCTTTATAAGAGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-857s1c1
Sequence:CCGGGTTTGCTAAGGCAAACACGAACTCGAGTTCGTGTTTGCCTTAGCAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162443    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-739s1c1
Sequence:CCGGCATCTAAACAGCCTGTAGGTTCTCGAGAACCTACAGGCTGTTTAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-929s1c1
Sequence:CCGGCAACACTGTACCTCAGTTCATCTCGAGATGAACTGAGGTACAGTGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-849s1c1
Sequence:CCGGCGACTAGAGTTTGCTAAGGCACTCGAGTGCCTTAGCAAACTCTAGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163703    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006867.1-734s1c1
Sequence:CCGGGCTCACATCTAAACAGCCTGTCTCGAGACAGGCTGTTTAGATGTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019733
RBPMS MISSION shRNA Bacterial Glycerol Stock
RNA binding protein with multiple splicing
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019733.1-907s1c1
Sequence:CCGGGCAATCTGTCTTGTGGGTATTCTCGAGAATACCCACAAGACAGATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019733.1-561s1c1
Sequence:CCGGCGCTACGACTAGAGTTTGCTACTCGAGTAGCAAACTCTAGTCGTAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019733.1-566s1c1
Sequence:CCGGCGACTAGAGTTTGCTAAGGCACTCGAGTGCCTTAGCAAACTCTAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019733.1-684s1c1
Sequence:CCGGAGCTCACAGTACCTGCACTTTCTCGAGAAAGTGCAGGTACTGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019733.1-452s1c1
Sequence:CCGGCTCACATCTAAACAGCCCGTACTCGAGTACGGGCTGTTTAGATGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019733
RBPMS MISSION shRNA shRNA Plasmid DNA
RNA binding protein with multiple splicing
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019733.1-907s1c1
Sequence:CCGGGCAATCTGTCTTGTGGGTATTCTCGAGAATACCCACAAGACAGATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019733.1-561s1c1
Sequence:CCGGCGCTACGACTAGAGTTTGCTACTCGAGTAGCAAACTCTAGTCGTAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019733.1-566s1c1
Sequence:CCGGCGACTAGAGTTTGCTAAGGCACTCGAGTGCCTTAGCAAACTCTAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019733.1-684s1c1
Sequence:CCGGAGCTCACAGTACCTGCACTTTCTCGAGAAAGTGCAGGTACTGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019733.1-452s1c1
Sequence:CCGGCTCACATCTAAACAGCCCGTACTCGAGTACGGGCTGTTTAGATGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019733
RBPMS MISSION shRNA Lentiviral Transduction Particles
RNA binding protein with multiple splicing
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123734    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019733.1-907s1c1
Sequence:CCGGGCAATCTGTCTTGTGGGTATTCTCGAGAATACCCACAAGACAGATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019733.1-561s1c1
Sequence:CCGGCGCTACGACTAGAGTTTGCTACTCGAGTAGCAAACTCTAGTCGTAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019733.1-566s1c1
Sequence:CCGGCGACTAGAGTTTGCTAAGGCACTCGAGTGCCTTAGCAAACTCTAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019733.1-684s1c1
Sequence:CCGGAGCTCACAGTACCTGCACTTTCTCGAGAAAGTGCAGGTACTGTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019733.1-452s1c1
Sequence:CCGGCTCACATCTAAACAGCCCGTACTCGAGTACGGGCTGTTTAGATGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)