EMAIL THIS PAGE TO A FRIEND

RBX1

ring-box 1, E3 ubiquitin protein ligase

77 Gene Product Result for
Synonyms: BA554C12.1 RNF75 ROC1
UniProtKB ID: P62877, B2RDY1, Q8N6Z8, Q9D1S2, Q9WUK9, Q9Y254
Gene ID:
Human(9978) Summary: This locus encodes a RING finger-like domain-containing protein. The encoded protein interacts with cullin proteins and likely plays a role in ubiquitination processes necessary for cell cycle progression. This protein may also affect protein turnover. Related pseudogenes exist on chromosomes 2 and 5.[provided by RefSeq, Sep 2010]
Mouse(56438) ring-box 1
Rat(300084) ring-box 1, E3 ubiquitin protein ligase
Thale Cress(832179) RING-box protein 1
dog(474494) ring-box 1, E3 ubiquitin protein ligase
domestic cat(101087758) ring-box 1, E3 ubiquitin protein ligase
chicken(418001) ring-box 1, E3 ubiquitin protein ligase
Zebrafish(449846) ring-box 1, E3 ubiquitin protein ligase
naked mole-rat(101712475) ring-box 1, E3 ubiquitin protein ligase
domestic guinea pig(100714763) ring-box 1, E3 ubiquitin protein ligase
cow(518880) ring-box 1, E3 ubiquitin protein ligase
sheep(101109871) ring-box 1, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014248 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014248 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014248 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019712 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019712 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019712 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055711 MISSION® esiRNA esiRNA human RBX1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014248 Rosetta Predictions human pricing
NM_001034135 Rosetta Predictions rat pricing
NM_019712 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066597 predicted 197
2 SASI_Hs01_00066598 predicted 195
3 SASI_Hs01_00066599 predicted 198
4 SASI_Hs01_00066600 predicted 235
5 SASI_Hs01_00066601 predicted 188
6 SASI_Hs01_00066603 predicted 69
7 SASI_Hs01_00066605 predicted 257
8 SASI_Hs01_00066606 predicted 290
9 SASI_Hs02_00345303 predicted 154
10 SASI_Hs02_00345304 predicted 167
11 SASI_Hs01_00066602 predicted 357
12 SASI_Hs01_00066604 predicted 181
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034135 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039855 predicted 697
2 SASI_Rn01_00039858 predicted 827
3 SASI_Rn01_00039859 predicted 480
4 SASI_Rn01_00039860 predicted 219
5 SASI_Rn02_00203984 predicted 811
6 SASI_Rn01_00039862 predicted 570
7 SASI_Rn01_00039863 predicted 652
8 SASI_Rn02_00203985 predicted 252
9 SASI_Rn01_00039864 predicted 483
10 SASI_Rn02_00203986 predicted 814
11 SASI_Rn01_00039856 predicted 332
12 SASI_Rn01_00039857 predicted 625
13 SASI_Rn01_00039861 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019712 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178985 predicted 865
2 SASI_Mm01_00178986 predicted 641
3 SASI_Mm02_00324825 predicted 617
4 SASI_Mm01_00178988 predicted 700
5 SASI_Mm01_00178989 predicted 268
6 SASI_Mm01_00178990 predicted 427
7 SASI_Mm01_00178991 predicted 816
8 SASI_Mm01_00178992 predicted 383
9 SASI_Mm01_00178993 predicted 649
10 SASI_Mm01_00178994 predicted 491
11 SASI_Mm01_00178987 predicted 805
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014248
VALIDATED
RBX1 MISSION shRNA Bacterial Glycerol Stock
ring-box 1, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014248.2-156s21c1
Sequence:CCGGGAACCACATTATGGATCTTTGCTCGAGCAAAGATCCATAATGTGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014248.2-395s21c1
Sequence:CCGGCTTTCCCTGCTGTTACCTAATCTCGAGATTAGGTAACAGCAGGGAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014248.2-257s21c1
Sequence:CCGGACTTCCACTGCATCTCTCGCTCTCGAGAGCGAGAGATGCAGTGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_014248.2-183s21c1
Sequence:CCGGATGTCAAGCTAACCAGGCGTCCTCGAGGACGCCTGGTTAGCTTGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014248.2-121s21c1
Sequence:CCGGTGGGATATTGTGGTTGATAACCTCGAGGTTATCAACCACAATATCCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022384    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014248.2-395s1c1
Sequence:CCGGCTTTCCCTGCTGTTACCTAATCTCGAGATTAGGTAACAGCAGGGAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014248.2-264s1c1
Sequence:CCGGCTGCATCTCTCGCTGGCTCAACTCGAGTTGAGCCAGCGAGAGATGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022387    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014248.2-263s1c1
Sequence:CCGGACTGCATCTCTCGCTGGCTCACTCGAGTGAGCCAGCGAGAGATGCAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022388    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014248.2-183s1c1
Sequence:CCGGATGTCAAGCTAACCAGGCGTCCTCGAGGACGCCTGGTTAGCTTGACATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014248
VALIDATED
RBX1 MISSION shRNA shRNA Plasmid DNA
ring-box 1, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014248.2-156s21c1
Sequence:CCGGGAACCACATTATGGATCTTTGCTCGAGCAAAGATCCATAATGTGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014248.2-395s21c1
Sequence:CCGGCTTTCCCTGCTGTTACCTAATCTCGAGATTAGGTAACAGCAGGGAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014248.2-257s21c1
Sequence:CCGGACTTCCACTGCATCTCTCGCTCTCGAGAGCGAGAGATGCAGTGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_014248.2-183s21c1
Sequence:CCGGATGTCAAGCTAACCAGGCGTCCTCGAGGACGCCTGGTTAGCTTGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014248.2-121s21c1
Sequence:CCGGTGGGATATTGTGGTTGATAACCTCGAGGTTATCAACCACAATATCCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022384    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014248.2-395s1c1
Sequence:CCGGCTTTCCCTGCTGTTACCTAATCTCGAGATTAGGTAACAGCAGGGAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014248.2-264s1c1
Sequence:CCGGCTGCATCTCTCGCTGGCTCAACTCGAGTTGAGCCAGCGAGAGATGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022387    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014248.2-263s1c1
Sequence:CCGGACTGCATCTCTCGCTGGCTCACTCGAGTGAGCCAGCGAGAGATGCAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022388    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014248.2-183s1c1
Sequence:CCGGATGTCAAGCTAACCAGGCGTCCTCGAGGACGCCTGGTTAGCTTGACATTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014248
VALIDATED
RBX1 MISSION shRNA Lentiviral Transduction Particles
ring-box 1, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014248.2-156s21c1
Sequence:CCGGGAACCACATTATGGATCTTTGCTCGAGCAAAGATCCATAATGTGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272586    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_014248.2-395s21c1
Sequence:CCGGCTTTCCCTGCTGTTACCTAATCTCGAGATTAGGTAACAGCAGGGAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272523    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014248.2-257s21c1
Sequence:CCGGACTTCCACTGCATCTCTCGCTCTCGAGAGCGAGAGATGCAGTGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272522    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_014248.2-183s21c1
Sequence:CCGGATGTCAAGCTAACCAGGCGTCCTCGAGGACGCCTGGTTAGCTTGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272521    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014248.2-121s21c1
Sequence:CCGGTGGGATATTGTGGTTGATAACCTCGAGGTTATCAACCACAATATCCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022384    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_014248.2-395s1c1
Sequence:CCGGCTTTCCCTGCTGTTACCTAATCTCGAGATTAGGTAACAGCAGGGAAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_014248.2-264s1c1
Sequence:CCGGCTGCATCTCTCGCTGGCTCAACTCGAGTTGAGCCAGCGAGAGATGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022387    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014248.2-263s1c1
Sequence:CCGGACTGCATCTCTCGCTGGCTCACTCGAGTGAGCCAGCGAGAGATGCAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022388    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_014248.2-183s1c1
Sequence:CCGGATGTCAAGCTAACCAGGCGTCCTCGAGGACGCCTGGTTAGCTTGACATTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019712
VALIDATED
RBX1 MISSION shRNA Bacterial Glycerol Stock
ring-box 1, E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019712.3-198s21c1
Sequence:CCGGCCACATTATGGATCTTTGTATCTCGAGATACAAAGATCCATAATGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019712.3-817s21c1
Sequence:CCGGCATCTCATGATGGAGTCTAAGCTCGAGCTTAGACTCCATCATGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019712.3-251s21c1
Sequence:CCGGCCGAAGAGTGTACGGTTGCATCTCGAGATGCAACCGTACACTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019712.3-304s21c1
Sequence:CCGGTGCATCTCTCGATGGCTCAAACTCGAGTTTGAGCCATCGAGAGATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019712.3-273s21c1
Sequence:CCGGGGGAGTCTGCAACCATGCTTTCTCGAGAAAGCATGGTTGCAGACTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019712.2-194s1c1
Sequence:CCGGCCGAAGAGTGTACGGTTGCATCTCGAGATGCAACCGTACACTCTTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019712.2-298s1c1
Sequence:CCGGGAGTGGGAGTTCCAGAAGTATCTCGAGATACTTCTGGAACTCCCACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019712.2-141s1c1
Sequence:CCGGCCACATTATGGATCTTTGTATCTCGAGATACAAAGATCCATAATGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019712.2-101s1c1
Sequence:CCGGCCTGGGACATTGTGGTTGATACTCGAGTATCAACCACAATGTCCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019712.2-1097s1c1
Sequence:CCGGCCGTGTTCAATTGCTGGCATACTCGAGTATGCCAGCAATTGAACACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019712
VALIDATED
RBX1 MISSION shRNA shRNA Plasmid DNA
ring-box 1, E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019712.3-198s21c1
Sequence:CCGGCCACATTATGGATCTTTGTATCTCGAGATACAAAGATCCATAATGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019712.3-817s21c1
Sequence:CCGGCATCTCATGATGGAGTCTAAGCTCGAGCTTAGACTCCATCATGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019712.3-251s21c1
Sequence:CCGGCCGAAGAGTGTACGGTTGCATCTCGAGATGCAACCGTACACTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019712.3-304s21c1
Sequence:CCGGTGCATCTCTCGATGGCTCAAACTCGAGTTTGAGCCATCGAGAGATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019712.3-273s21c1
Sequence:CCGGGGGAGTCTGCAACCATGCTTTCTCGAGAAAGCATGGTTGCAGACTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019712.2-194s1c1
Sequence:CCGGCCGAAGAGTGTACGGTTGCATCTCGAGATGCAACCGTACACTCTTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019712.2-298s1c1
Sequence:CCGGGAGTGGGAGTTCCAGAAGTATCTCGAGATACTTCTGGAACTCCCACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019712.2-141s1c1
Sequence:CCGGCCACATTATGGATCTTTGTATCTCGAGATACAAAGATCCATAATGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019712.2-101s1c1
Sequence:CCGGCCTGGGACATTGTGGTTGATACTCGAGTATCAACCACAATGTCCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019712.2-1097s1c1
Sequence:CCGGCCGTGTTCAATTGCTGGCATACTCGAGTATGCCAGCAATTGAACACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019712
VALIDATED
RBX1 MISSION shRNA Lentiviral Transduction Particles
ring-box 1, E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019712.3-198s21c1
Sequence:CCGGCCACATTATGGATCTTTGTATCTCGAGATACAAAGATCCATAATGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273727    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019712.3-817s21c1
Sequence:CCGGCATCTCATGATGGAGTCTAAGCTCGAGCTTAGACTCCATCATGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019712.3-251s21c1
Sequence:CCGGCCGAAGAGTGTACGGTTGCATCTCGAGATGCAACCGTACACTCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019712.3-304s21c1
Sequence:CCGGTGCATCTCTCGATGGCTCAAACTCGAGTTTGAGCCATCGAGAGATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019712.3-273s21c1
Sequence:CCGGGGGAGTCTGCAACCATGCTTTCTCGAGAAAGCATGGTTGCAGACTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019712.2-194s1c1
Sequence:CCGGCCGAAGAGTGTACGGTTGCATCTCGAGATGCAACCGTACACTCTTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019712.2-298s1c1
Sequence:CCGGGAGTGGGAGTTCCAGAAGTATCTCGAGATACTTCTGGAACTCCCACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019712.2-141s1c1
Sequence:CCGGCCACATTATGGATCTTTGTATCTCGAGATACAAAGATCCATAATGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019712.2-101s1c1
Sequence:CCGGCCTGGGACATTGTGGTTGATACTCGAGTATCAACCACAATGTCCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012868    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019712.2-1097s1c1
Sequence:CCGGCCGTGTTCAATTGCTGGCATACTCGAGTATGCCAGCAATTGAACACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)