EMAIL THIS PAGE TO A FRIEND

RC3H1

ring finger and CCCH-type domains 1

147 Gene Product Result for
Synonyms: RNF198 ROQUIN
UniProtKB ID: Q5TC82, B3KVK1, Q5W180, Q5W181, Q8IVE6, Q8N9V1
Gene ID:
Human(149041) Summary: RC3H1, or roquin, encodes a highly conserved member of the RING type ubiquitin ligase protein family (Vinuesa et al., 2005 [PubMed 15917799]
Mouse(381305) RING CCCH (C3H) domains 1
Rat(680586) ring finger and CCCH-type domains 1
Zebrafish(568568) ring finger and CCCH-type zinc finger domains 1
chicken(424439) ring finger and CCCH-type domains 1
Horse(100052499) ring finger and CCCH-type domains 1
dog(480065) ring finger and CCCH-type domains 1
cow(100336754) ring finger and CCCH-type domains 1
cow(789395) ring finger and CCCH-type domains 1
sheep(101114887) ring finger and CCCH-type domains 1
domestic guinea pig(100730486) ring finger and CCCH-type domains 1
naked mole-rat(101698119) ring finger and CCCH-type domains 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172071 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172071 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172071 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024952 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024952 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024952 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172071 Rosetta Predictions human pricing
XM_001057889 Rosetta Predictions rat pricing
NM_001024952 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217989 predicted 939
2 SASI_Hs02_00367797 predicted 1145
3 SASI_Hs01_00217990 predicted 1938
4 SASI_Hs01_00217991 predicted 1076
5 SASI_Hs01_00217992 predicted 903
6 SASI_Hs01_00217993 predicted 237
7 SASI_Hs01_00217995 predicted 1122
8 SASI_Hs02_00367798 predicted 1798
9 SASI_Hs02_00367799 predicted 3075
10 SASI_Hs01_00217997 predicted 1033
11 SASI_Hs01_00217994 predicted 1636
12 SASI_Hs01_00217996 predicted 1786
13 SASI_Hs01_00217998 predicted 1995
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057889 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287873 predicted 505
2 SASI_Rn02_00287874 predicted 502
3 SASI_Rn02_00287875 predicted 344
4 SASI_Rn02_00287876 predicted 497
5 SASI_Rn02_00287877 predicted 204
6 SASI_Rn02_00287878 predicted 488
7 SASI_Rn02_00287879 predicted 306
8 SASI_Rn02_00287880 predicted 297
9 SASI_Rn02_00287881 predicted 317
10 SASI_Rn02_00287882 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024952 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150265 predicted 3162
2 SASI_Mm01_00150266 predicted 3149
3 SASI_Mm01_00150267 predicted 2538
4 SASI_Mm02_00287757 predicted 3790
5 SASI_Mm02_00287758 predicted 3712
6 SASI_Mm01_00150269 predicted 1209
7 SASI_Mm01_00150270 predicted 2252
8 SASI_Mm01_00150271 predicted 1154
9 SASI_Mm01_00150272 predicted 2496
10 SASI_Mm01_00150273 predicted 964
11 SASI_Mm01_00150268 predicted 1232
12 SASI_Mm01_00150274 predicted 759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172071
VALIDATED
RC3H1 MISSION shRNA Bacterial Glycerol Stock
ring finger and CCCH-type domains 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000140092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_172071.1-3458s1c1
Sequence:CCGGGATCAGGAGTTACTCCCAGTTCTCGAGAACTGGGAGTAACTCCTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172071.1-4401s1c1
Sequence:CCGGGCTGACATCATAGGATGCTAACTCGAGTTAGCATCCTATGATGTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_172071.1-129s1c1
Sequence:CCGGCCCAATTTGCACTCAGACTTTCTCGAGAAAGTCTGAGTGCAAATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172071.1-1126s1c1
Sequence:CCGGCCAGCAAACTTGAACCGACTACTCGAGTAGTCGGTTCAAGTTTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172071.1-210s1c1
Sequence:CCGGCCTGAATAAACTCCACCGCAACTCGAGTTGCGGTGGAGTTTATTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172071.2-2136s21c1
Sequence:CCGGAGAAGAGATATTCCGAGAAAGCTCGAGCTTTCTCGGAATATCTCTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172071.1-629s1c1
Sequence:CCGGCCAATCTTTGGGCAGCAGTAACTCGAGTTACTGCTGCCCAAAGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172071.1-2997s1c1
Sequence:CCGGGCAGCAATTGAACCATCAGATCTCGAGATCTGATGGTTCAATTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172071.2-2626s21c1
Sequence:CCGGGGAATGAGGGACCAGCGATTACTCGAGTAATCGCTGGTCCCTCATTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_172071.1-2032s1c1
Sequence:CCGGCGTGTTGTAAACTCTCAGTATCTCGAGATACTGAGAGTTTACAACACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172071.1-784s1c1
Sequence:CCGGCGGTTTCCTCAAGCCTCTAAACTCGAGTTTAGAGGCTTGAGGAAACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172071.1-1561s1c1
Sequence:CCGGGCTCTGCCAAATGGAATTGTACTCGAGTACAATTCCATTTGGCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172071.1-1701s1c1
Sequence:CCGGCCTGCTAGAATCTGTTCCTAACTCGAGTTAGGAACAGATTCTAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172071.2-1084s21c1
Sequence:CCGGAGTGTTCAGGAACTAACAATTCTCGAGAATTGTTAGTTCCTGAACACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172071.2-3818s21c1
Sequence:CCGGTACACTCTGTTTGATTAATTGCTCGAGCAATTAATCAAACAGAGTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172071.2-1467s21c1
Sequence:CCGGTGCCTCTTTGGGTCAACTTAACTCGAGTTAAGTTGACCCAAAGAGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172071
VALIDATED
RC3H1 MISSION shRNA shRNA Plasmid DNA
ring finger and CCCH-type domains 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000140092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_172071.1-3458s1c1
Sequence:CCGGGATCAGGAGTTACTCCCAGTTCTCGAGAACTGGGAGTAACTCCTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172071.1-4401s1c1
Sequence:CCGGGCTGACATCATAGGATGCTAACTCGAGTTAGCATCCTATGATGTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_172071.1-129s1c1
Sequence:CCGGCCCAATTTGCACTCAGACTTTCTCGAGAAAGTCTGAGTGCAAATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172071.1-1126s1c1
Sequence:CCGGCCAGCAAACTTGAACCGACTACTCGAGTAGTCGGTTCAAGTTTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172071.1-210s1c1
Sequence:CCGGCCTGAATAAACTCCACCGCAACTCGAGTTGCGGTGGAGTTTATTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172071.2-2136s21c1
Sequence:CCGGAGAAGAGATATTCCGAGAAAGCTCGAGCTTTCTCGGAATATCTCTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172071.1-629s1c1
Sequence:CCGGCCAATCTTTGGGCAGCAGTAACTCGAGTTACTGCTGCCCAAAGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172071.1-2997s1c1
Sequence:CCGGGCAGCAATTGAACCATCAGATCTCGAGATCTGATGGTTCAATTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172071.2-2626s21c1
Sequence:CCGGGGAATGAGGGACCAGCGATTACTCGAGTAATCGCTGGTCCCTCATTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_172071.1-2032s1c1
Sequence:CCGGCGTGTTGTAAACTCTCAGTATCTCGAGATACTGAGAGTTTACAACACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172071.1-784s1c1
Sequence:CCGGCGGTTTCCTCAAGCCTCTAAACTCGAGTTTAGAGGCTTGAGGAAACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172071.1-1561s1c1
Sequence:CCGGGCTCTGCCAAATGGAATTGTACTCGAGTACAATTCCATTTGGCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172071.1-1701s1c1
Sequence:CCGGCCTGCTAGAATCTGTTCCTAACTCGAGTTAGGAACAGATTCTAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172071.2-1084s21c1
Sequence:CCGGAGTGTTCAGGAACTAACAATTCTCGAGAATTGTTAGTTCCTGAACACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172071.2-3818s21c1
Sequence:CCGGTACACTCTGTTTGATTAATTGCTCGAGCAATTAATCAAACAGAGTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172071.2-1467s21c1
Sequence:CCGGTGCCTCTTTGGGTCAACTTAACTCGAGTTAAGTTGACCCAAAGAGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172071
VALIDATED
RC3H1 MISSION shRNA Lentiviral Transduction Particles
ring finger and CCCH-type domains 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000140092    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_172071.1-3458s1c1
Sequence:CCGGGATCAGGAGTTACTCCCAGTTCTCGAGAACTGGGAGTAACTCCTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172071.1-4401s1c1
Sequence:CCGGGCTGACATCATAGGATGCTAACTCGAGTTAGCATCCTATGATGTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_172071.1-129s1c1
Sequence:CCGGCCCAATTTGCACTCAGACTTTCTCGAGAAAGTCTGAGTGCAAATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172071.1-1126s1c1
Sequence:CCGGCCAGCAAACTTGAACCGACTACTCGAGTAGTCGGTTCAAGTTTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172071.1-210s1c1
Sequence:CCGGCCTGAATAAACTCCACCGCAACTCGAGTTGCGGTGGAGTTTATTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432078    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172071.2-2136s21c1
Sequence:CCGGAGAAGAGATATTCCGAGAAAGCTCGAGCTTTCTCGGAATATCTCTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172071.1-629s1c1
Sequence:CCGGCCAATCTTTGGGCAGCAGTAACTCGAGTTACTGCTGCCCAAAGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172071.1-2997s1c1
Sequence:CCGGGCAGCAATTGAACCATCAGATCTCGAGATCTGATGGTTCAATTGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172071.2-2626s21c1
Sequence:CCGGGGAATGAGGGACCAGCGATTACTCGAGTAATCGCTGGTCCCTCATTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_172071.1-2032s1c1
Sequence:CCGGCGTGTTGTAAACTCTCAGTATCTCGAGATACTGAGAGTTTACAACACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172071.1-784s1c1
Sequence:CCGGCGGTTTCCTCAAGCCTCTAAACTCGAGTTTAGAGGCTTGAGGAAACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142153    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172071.1-1561s1c1
Sequence:CCGGGCTCTGCCAAATGGAATTGTACTCGAGTACAATTCCATTTGGCAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142634    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172071.1-1701s1c1
Sequence:CCGGCCTGCTAGAATCTGTTCCTAACTCGAGTTAGGAACAGATTCTAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172071.2-1084s21c1
Sequence:CCGGAGTGTTCAGGAACTAACAATTCTCGAGAATTGTTAGTTCCTGAACACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415281    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172071.2-3818s21c1
Sequence:CCGGTACACTCTGTTTGATTAATTGCTCGAGCAATTAATCAAACAGAGTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172071.2-1467s21c1
Sequence:CCGGTGCCTCTTTGGGTCAACTTAACTCGAGTTAAGTTGACCCAAAGAGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024952
VALIDATED
RC3H1 MISSION shRNA Bacterial Glycerol Stock
ring finger and CCCH-type domains 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000177150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024952.1-2145s1c1
Sequence:CCGGGCAGATGTTTATTATCAGGATCTCGAGATCCTGATAATAAACATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024952.1-2010s1c1
Sequence:CCGGCCTAAGAGTATTTCTGCCTTACTCGAGTAAGGCAGAAATACTCTTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024952.1-675s1c1
Sequence:CCGGGCCAAGAAATGTGTAGAAGAACTCGAGTTCTTCTACACATTTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024952.1-870s1c1
Sequence:CCGGCGCACAGTTACAGAGCTCATTCTCGAGAATGAGCTCTGTAACTGTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024952.1-502s1c1
Sequence:CCGGGCCTGAATAAACTCCACCGTACTCGAGTACGGTGGAGTTTATTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024952.1-3419s1c1
Sequence:CCGGGCCTGGAATGATCTCAAGTGACTCGAGTCACTTGAGATCATTCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024952.2-8198s1c1
Sequence:CCGGCTTAGTACCTGTTCGACTTAACTCGAGTTAAGTCGAACAGGTACTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024952.2-603s1c1
Sequence:CCGGCCACTATCAATACGGACATTGCTCGAGCAATGTCCGTATTGATAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024952
VALIDATED
RC3H1 MISSION shRNA shRNA Plasmid DNA
ring finger and CCCH-type domains 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000177150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024952.1-2145s1c1
Sequence:CCGGGCAGATGTTTATTATCAGGATCTCGAGATCCTGATAATAAACATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024952.1-2010s1c1
Sequence:CCGGCCTAAGAGTATTTCTGCCTTACTCGAGTAAGGCAGAAATACTCTTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024952.1-675s1c1
Sequence:CCGGGCCAAGAAATGTGTAGAAGAACTCGAGTTCTTCTACACATTTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024952.1-870s1c1
Sequence:CCGGCGCACAGTTACAGAGCTCATTCTCGAGAATGAGCTCTGTAACTGTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024952.1-502s1c1
Sequence:CCGGGCCTGAATAAACTCCACCGTACTCGAGTACGGTGGAGTTTATTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024952.1-3419s1c1
Sequence:CCGGGCCTGGAATGATCTCAAGTGACTCGAGTCACTTGAGATCATTCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000216632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024952.2-8198s1c1
Sequence:CCGGCTTAGTACCTGTTCGACTTAACTCGAGTTAAGTCGAACAGGTACTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024952.2-603s1c1
Sequence:CCGGCCACTATCAATACGGACATTGCTCGAGCAATGTCCGTATTGATAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024952
VALIDATED
RC3H1 MISSION shRNA Lentiviral Transduction Particles
ring finger and CCCH-type domains 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000177150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024952.1-2145s1c1
Sequence:CCGGGCAGATGTTTATTATCAGGATCTCGAGATCCTGATAATAAACATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024952.1-2010s1c1
Sequence:CCGGCCTAAGAGTATTTCTGCCTTACTCGAGTAAGGCAGAAATACTCTTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024952.1-675s1c1
Sequence:CCGGGCCAAGAAATGTGTAGAAGAACTCGAGTTCTTCTACACATTTCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024952.1-870s1c1
Sequence:CCGGCGCACAGTTACAGAGCTCATTCTCGAGAATGAGCTCTGTAACTGTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001024952.1-502s1c1
Sequence:CCGGGCCTGAATAAACTCCACCGTACTCGAGTACGGTGGAGTTTATTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024952.1-3419s1c1
Sequence:CCGGGCCTGGAATGATCTCAAGTGACTCGAGTCACTTGAGATCATTCCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000216632    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001024952.2-8198s1c1
Sequence:CCGGCTTAGTACCTGTTCGACTTAACTCGAGTTAAGTCGAACAGGTACTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001024952.2-603s1c1
Sequence:CCGGCCACTATCAATACGGACATTGCTCGAGCAATGTCCGTATTGATAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)