EMAIL THIS PAGE TO A FRIEND

RC3H2

ring finger and CCCH-type domains 2

99 Gene Product Result for
Synonyms: MNAB RNF164
Gene ID:
Mouse(319817) ring finger and CCCH-type zinc finger domains 2
Rat(311909) ring finger and CCCH-type domains 2
naked mole-rat(101700691) ring finger and CCCH-type domains 2
domestic guinea pig(100713655) ring finger and CCCH-type domains 2
cow(783330) ring finger and CCCH-type domains 2
sheep(101110920) ring finger and CCCH-type domains 2
Zebrafish(559834) ring finger and CCCH-type domains 2
chicken(417109) ring finger and CCCH-type domains 2
dog(491344) ring finger and CCCH-type domains 2
Horse(100067476) ring finger and CCCH-type domains 2
domestic cat(101100678) ring finger and CCCH-type domains 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001100591 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001100591 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001100591 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018835 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018835 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018835 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100588 Rosetta Predictions human pricing
NM_018835 Rosetta Predictions human pricing
NM_001107839 Rosetta Predictions rat pricing
NM_001100591 Rosetta Predictions mouse pricing
XM_001000931 Rosetta Predictions mouse pricing
XM_130233 Rosetta Predictions mouse pricing
XM_901554 Rosetta Predictions mouse pricing
XM_901559 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100588 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322154 predicted 1818
2 SASI_Hs02_00322155 predicted 2571
3 SASI_Hs02_00322156 predicted 482
4 SASI_Hs02_00322157 predicted 575
5 SASI_Hs02_00322158 predicted 761
6 SASI_Hs02_00322159 predicted 3061
7 SASI_Hs02_00322160 predicted 1755
8 SASI_Hs02_00322161 predicted 2410
9 SASI_Hs02_00322162 predicted 721
10 SASI_Hs02_00322163 predicted 2825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221322 predicted 1815
2 SASI_Hs01_00221323 predicted 2569
3 SASI_Hs02_00352279 predicted 475
4 SASI_Hs02_00352280 predicted 575
5 SASI_Hs02_00352281 predicted 754
6 SASI_Hs01_00221324 predicted 3062
7 SASI_Hs01_00221325 predicted 1749
8 SASI_Hs02_00352282 predicted 2417
9 SASI_Hs02_00352283 predicted 721
10 SASI_Hs01_00221327 predicted 2821
11 SASI_Hs01_00221326 predicted 2103
12 SASI_Hs01_00221328 predicted 280
13 SASI_Hs01_00221329 predicted 1146
14 SASI_Hs01_00221330 predicted 2491
15 SASI_Hs01_00221331 predicted 1863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107839 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232785 predicted 1589
2 SASI_Rn02_00232786 predicted 2704
3 SASI_Rn02_00232787 predicted 582
4 SASI_Rn02_00232788 predicted 2463
5 SASI_Rn02_00232789 predicted 384
6 SASI_Rn02_00232790 predicted 1179
7 SASI_Rn02_00232791 predicted 2677
8 SASI_Rn02_00232792 predicted 3410
9 SASI_Rn02_00232793 predicted 891
10 SASI_Rn02_00232794 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100591 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302264 predicted 1643
2 SASI_Mm02_00302265 predicted 2294
3 SASI_Mm02_00302266 predicted 3387
4 SASI_Mm02_00302267 predicted 477
5 SASI_Mm02_00302268 predicted 3019
6 SASI_Mm02_00302269 predicted 970
7 SASI_Mm02_00302270 predicted 3046
8 SASI_Mm02_00302271 predicted 2753
9 SASI_Mm02_00302272 predicted 1078
10 SASI_Mm02_00302273 predicted 2664
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001000931 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285642 predicted 708
2 SASI_Mm01_00285643 predicted 427
3 SASI_Mm01_00285644 predicted 531
4 SASI_Mm01_00285645 predicted 360
5 SASI_Mm01_00285646 predicted 543
6 SASI_Mm01_00285647 predicted 521
7 SASI_Mm01_00285648 predicted 553
8 SASI_Mm01_00285649 predicted 500
9 SASI_Mm01_00285650 predicted 387
10 SASI_Mm01_00285651 predicted 476
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130233 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00206778 predicted 1641
2 SASI_Mm01_00206779 predicted 2301
3 SASI_Mm01_00206780 predicted 3391
4 SASI_Mm01_00206781 predicted 485
5 SASI_Mm01_00206782 predicted 3029
6 SASI_Mm01_00206783 predicted 3044
7 SASI_Mm01_00206784 predicted 879
8 SASI_Mm01_00206785 predicted 2760
9 SASI_Mm01_00206786 predicted 1081
10 SASI_Mm01_00206787 predicted 2673
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203858 predicted 764
2 SASI_Mm01_00203859 predicted 756
3 SASI_Mm01_00203860 predicted 768
4 SASI_Mm01_00203861 predicted 798
5 SASI_Mm01_00203862 predicted 795
6 SASI_Mm01_00203863 predicted 797
7 SASI_Mm01_00203864 predicted 794
8 SASI_Mm01_00203865 predicted 763
9 SASI_Mm01_00203866 predicted 778
10 SASI_Mm01_00203867 predicted 792
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901559 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215004 predicted 1030
2 SASI_Mm01_00215005 predicted 610
3 SASI_Mm01_00215006 predicted 509
4 SASI_Mm01_00215007 predicted 757
5 SASI_Mm01_00215008 predicted 898
6 SASI_Mm01_00215009 predicted 1081
7 SASI_Mm01_00215010 predicted 724
8 SASI_Mm01_00215011 predicted 727
9 SASI_Mm01_00215012 predicted 749
10 SASI_Mm01_00215013 predicted 822
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001100591
RC3H2 MISSION shRNA Bacterial Glycerol Stock
ring finger and CCCH-type domains 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100591.1-1105s21c1
Sequence:CCGGTGGAAGCAGGACTCCGTATTTCTCGAGAAATACGGAGTCCTGCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100591.1-2918s21c1
Sequence:CCGGCTTTAGTGACGGACCCATTATCTCGAGATAATGGGTCCGTCACTAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100591.1-3108s21c1
Sequence:GTACCGGACATCATCAGCACACTATATTCTCGAGAATATAGTGTGCTGATGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100591.1-2790s21c1
Sequence:CCGGTCGGAGCCCAAAGACGTAATTCTCGAGAATTACGTCTTTGGGCTCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100591.1-2444s21c1
Sequence:CCGGCAACTCATTAGATGGATATTACTCGAGTAATATCCATCTAATGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100591.1-1984s21c1
Sequence:CCGGTAACTAGAGTTCCAGTATATCCTCGAGGATATACTGGAACTCTAGTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100591.1-5338s21c1
Sequence:CCGGATTGGTCGTCTGAGCTATTTACTCGAGTAAATAGCTCAGACGACCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001100591
RC3H2 MISSION shRNA shRNA Plasmid DNA
ring finger and CCCH-type domains 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100591.1-1105s21c1
Sequence:CCGGTGGAAGCAGGACTCCGTATTTCTCGAGAAATACGGAGTCCTGCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100591.1-2918s21c1
Sequence:CCGGCTTTAGTGACGGACCCATTATCTCGAGATAATGGGTCCGTCACTAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100591.1-3108s21c1
Sequence:GTACCGGACATCATCAGCACACTATATTCTCGAGAATATAGTGTGCTGATGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100591.1-2790s21c1
Sequence:CCGGTCGGAGCCCAAAGACGTAATTCTCGAGAATTACGTCTTTGGGCTCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100591.1-2444s21c1
Sequence:CCGGCAACTCATTAGATGGATATTACTCGAGTAATATCCATCTAATGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000226368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100591.1-1984s21c1
Sequence:CCGGTAACTAGAGTTCCAGTATATCCTCGAGGATATACTGGAACTCTAGTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000251864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100591.1-5338s21c1
Sequence:CCGGATTGGTCGTCTGAGCTATTTACTCGAGTAAATAGCTCAGACGACCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001100591
RC3H2 MISSION shRNA Lentiviral Transduction Particles
ring finger and CCCH-type domains 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100591.1-1105s21c1
Sequence:CCGGTGGAAGCAGGACTCCGTATTTCTCGAGAAATACGGAGTCCTGCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100591.1-2918s21c1
Sequence:CCGGCTTTAGTGACGGACCCATTATCTCGAGATAATGGGTCCGTCACTAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100591.1-3108s21c1
Sequence:GTACCGGACATCATCAGCACACTATATTCTCGAGAATATAGTGTGCTGATGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100591.1-2790s21c1
Sequence:CCGGTCGGAGCCCAAAGACGTAATTCTCGAGAATTACGTCTTTGGGCTCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100591.1-2444s21c1
Sequence:CCGGCAACTCATTAGATGGATATTACTCGAGTAATATCCATCTAATGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000226368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001100591.1-1984s21c1
Sequence:CCGGTAACTAGAGTTCCAGTATATCCTCGAGGATATACTGGAACTCTAGTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000251864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001100591.1-5338s21c1
Sequence:CCGGATTGGTCGTCTGAGCTATTTACTCGAGTAAATAGCTCAGACGACCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018835
VALIDATED
RC3H2 MISSION shRNA Bacterial Glycerol Stock
ring finger and CCCH-type domains 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018835.2-475s21c1
Sequence:CCGGACCAGATCATCAGTCAATTAACTCGAGTTAATTGACTGATGATCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018835.2-2143s21c1
Sequence:CCGGTCGCTTTGTGAGGTCCAATAACTCGAGTTATTGGACCTCACAAAGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018835.2-3041s21c1
Sequence:CCGGCCCATCAGTGTATCAGATTATCTCGAGATAATCTGATACACTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018835.2-725s21c1
Sequence:CCGGACTGTAACAGAACTGATATTACTCGAGTAATATCAGTTCTGTTACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_018835.2-1752s21c1
Sequence:CCGGCCCAGCTAATCTCACGTAGTACTCGAGTACTACGTGAGATTAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018835.1-2475s1c1
Sequence:CCGGCCCATCAGTGTATCAGATTATCTCGAGATAATCTGATACACTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018835.1-1186s1c1
Sequence:CCGGCCCAGCTAATCTCACGTAGTACTCGAGTACTACGTGAGATTAGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018835.1-2212s1c1
Sequence:CCGGCCTGTATAAATGCCATTGATTCTCGAGAATCAATGGCATTTATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018835
VALIDATED
RC3H2 MISSION shRNA shRNA Plasmid DNA
ring finger and CCCH-type domains 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018835.2-475s21c1
Sequence:CCGGACCAGATCATCAGTCAATTAACTCGAGTTAATTGACTGATGATCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018835.2-2143s21c1
Sequence:CCGGTCGCTTTGTGAGGTCCAATAACTCGAGTTATTGGACCTCACAAAGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018835.2-3041s21c1
Sequence:CCGGCCCATCAGTGTATCAGATTATCTCGAGATAATCTGATACACTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018835.2-725s21c1
Sequence:CCGGACTGTAACAGAACTGATATTACTCGAGTAATATCAGTTCTGTTACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_018835.2-1752s21c1
Sequence:CCGGCCCAGCTAATCTCACGTAGTACTCGAGTACTACGTGAGATTAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018835.1-2475s1c1
Sequence:CCGGCCCATCAGTGTATCAGATTATCTCGAGATAATCTGATACACTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018835.1-1186s1c1
Sequence:CCGGCCCAGCTAATCTCACGTAGTACTCGAGTACTACGTGAGATTAGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018835.1-2212s1c1
Sequence:CCGGCCTGTATAAATGCCATTGATTCTCGAGAATCAATGGCATTTATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018835
VALIDATED
RC3H2 MISSION shRNA Lentiviral Transduction Particles
ring finger and CCCH-type domains 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018835.2-475s21c1
Sequence:CCGGACCAGATCATCAGTCAATTAACTCGAGTTAATTGACTGATGATCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018835.2-2143s21c1
Sequence:CCGGTCGCTTTGTGAGGTCCAATAACTCGAGTTATTGGACCTCACAAAGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018835.2-3041s21c1
Sequence:CCGGCCCATCAGTGTATCAGATTATCTCGAGATAATCTGATACACTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_018835.2-725s21c1
Sequence:CCGGACTGTAACAGAACTGATATTACTCGAGTAATATCAGTTCTGTTACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_018835.2-1752s21c1
Sequence:CCGGCCCAGCTAATCTCACGTAGTACTCGAGTACTACGTGAGATTAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018835.1-2475s1c1
Sequence:CCGGCCCATCAGTGTATCAGATTATCTCGAGATAATCTGATACACTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018835.1-1186s1c1
Sequence:CCGGCCCAGCTAATCTCACGTAGTACTCGAGTACTACGTGAGATTAGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018835.1-2212s1c1
Sequence:CCGGCCTGTATAAATGCCATTGATTCTCGAGAATCAATGGCATTTATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)