EMAIL THIS PAGE TO A FRIEND

RCAN1

regulator of calcineurin 1

226 Gene Product Result for
Synonyms: ADAPT78 CSP1 DSC1 DSCR1 MCIP1 RCN1
Gene ID:
Human(1827) Summary: The protein encoded by this gene interacts with calcineurin A and inhibits calcineurin-dependent signaling pathways, possibly affecting central nervous system development. This gene is located in the minimal candidate region for the Down syndrome phenotype, and is overexpressed in the brain of Down syndrome fetuses. Chronic overexpression of this gene may lead to neurofibrillary tangles such as those associated with Alzheimer disease. Three transcript variants encoding three different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(54720) regulator of calcineurin 1
Rat(266766) regulator of calcineurin 1
chicken(418510) regulator of calcineurin 1
domestic cat(101085821) regulator of calcineurin 1
dog(607887) regulator of calcineurin 1
cow(539640) regulator of calcineurin 1
domestic guinea pig(100724800) regulator of calcineurin 1
naked mole-rat(101705243) regulator of calcineurin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019466 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019466 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019466 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004414 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004414 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004414 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004414 Rosetta Predictions human pricing
NM_203417 Rosetta Predictions human pricing
NM_203418 Rosetta Predictions human pricing
NM_153724 Rosetta Predictions rat pricing
NM_001081549 Rosetta Predictions mouse pricing
NM_019466 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014303 predicted 1319
2 SASI_Hs01_00014304 predicted 605
3 SASI_Hs01_00014305 predicted 943
4 SASI_Hs01_00014306 predicted 1174
5 SASI_Hs01_00014307 predicted 1312
6 SASI_Hs01_00014308 predicted 936
7 SASI_Hs01_00014311 predicted 1216
8 SASI_Hs02_00337560 predicted 1236
9 SASI_Hs01_00014312 predicted 1026
10 SASI_Hs02_00337561 predicted 1295
11 SASI_Hs01_00014309 predicted 1064
12 SASI_Hs01_00014310 predicted 1221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116170 predicted 1161
2 SASI_Hs01_00116171 predicted 455
3 SASI_Hs01_00116172 predicted 793
4 SASI_Hs01_00116173 predicted 1024
5 SASI_Hs01_00116174 predicted 1154
6 SASI_Hs01_00116175 predicted 782
7 SASI_Hs01_00116178 predicted 1059
8 SASI_Hs02_00373350 predicted 1087
9 SASI_Hs01_00116179 predicted 876
10 SASI_Hs02_00373351 predicted 1137
11 SASI_Hs01_00116176 predicted 910
12 SASI_Hs01_00116177 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203418 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035145 predicted 1292
2 SASI_Hs01_00035146 predicted 582
3 SASI_Hs01_00035147 predicted 925
4 SASI_Hs01_00035148 predicted 1150
5 SASI_Hs01_00035149 predicted 1289
6 SASI_Hs01_00035150 predicted 911
7 SASI_Hs01_00035153 predicted 1186
8 SASI_Hs02_00373352 predicted 1215
9 SASI_Hs01_00035154 predicted 1006
10 SASI_Hs02_00373353 predicted 1264
11 SASI_Hs01_00035151 predicted 1041
12 SASI_Hs01_00035152 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153724 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053594 predicted 211
2 SASI_Rn01_00053595 predicted 1143
3 SASI_Rn01_00053596 predicted 303
4 SASI_Rn02_00269018 predicted 306
5 SASI_Rn01_00053597 predicted 430
6 SASI_Rn01_00053598 predicted 734
7 SASI_Rn01_00053599 predicted 95
8 SASI_Rn01_00053601 predicted 1068
9 SASI_Rn01_00053602 predicted 319
10 SASI_Rn01_00053603 predicted 1152
11 SASI_Rn01_00053600 predicted 849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081549 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298660 predicted 1092
2 SASI_Mm02_00298661 predicted 1021
3 SASI_Mm02_00298662 predicted 1311
4 SASI_Mm02_00298663 predicted 1157
5 SASI_Mm02_00298664 predicted 1312
6 SASI_Mm02_00298665 predicted 370
7 SASI_Mm02_00298666 predicted 527
8 SASI_Mm02_00298667 predicted 597
9 SASI_Mm02_00298668 predicted 284
10 SASI_Mm02_00298669 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019466 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117992 predicted 958
2 SASI_Mm02_00324467 predicted 893
3 SASI_Mm02_00324468 predicted 1184
4 SASI_Mm02_00324469 predicted 1020
5 SASI_Mm01_00117984 predicted 1173
6 SASI_Mm01_00117986 predicted 237
7 SASI_Mm01_00117987 predicted 390
8 SASI_Mm01_00117988 predicted 465
9 SASI_Mm01_00117989 predicted 884
10 SASI_Mm01_00117990 predicted 1104
11 SASI_Mm01_00117985 predicted 939
12 SASI_Mm01_00117991 predicted 1171
13 SASI_Mm01_00117993 predicted 1161
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019466
VALIDATED
RCAN1 MISSION shRNA Bacterial Glycerol Stock
regulator of calcineurin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019466.2-225s1c1
Sequence:CCGGGCTTCAAACGTGTCCGGATAACTCGAGTTATCCGGACACGTTTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019466.2-1388s1c1
Sequence:CCGGCCCAAGTAGAACTTAGCCTAACTCGAGTTAGGCTAAGTTCTACTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019466.2-450s1c1
Sequence:CCGGCCGTCATAAATTACGATCTTTCTCGAGAAAGATCGTAATTTATGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019466.2-333s1c1
Sequence:CCGGCTCAGACTTTACACATAGGAACTCGAGTTCCTATGTGTAAAGTCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019466.2-112s1c1
Sequence:CCGGCCTGATTGCTTGTGTGGCAAACTCGAGTTTGCCACACAAGCAATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019466
VALIDATED
RCAN1 MISSION shRNA shRNA Plasmid DNA
regulator of calcineurin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019466.2-225s1c1
Sequence:CCGGGCTTCAAACGTGTCCGGATAACTCGAGTTATCCGGACACGTTTGAAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000105815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019466.2-1388s1c1
Sequence:CCGGCCCAAGTAGAACTTAGCCTAACTCGAGTTAGGCTAAGTTCTACTTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000105816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019466.2-450s1c1
Sequence:CCGGCCGTCATAAATTACGATCTTTCTCGAGAAAGATCGTAATTTATGACGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000105819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019466.2-333s1c1
Sequence:CCGGCTCAGACTTTACACATAGGAACTCGAGTTCCTATGTGTAAAGTCTGAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000105817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019466.2-112s1c1
Sequence:CCGGCCTGATTGCTTGTGTGGCAAACTCGAGTTTGCCACACAAGCAATCAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019466
VALIDATED
RCAN1 MISSION shRNA Lentiviral Transduction Particles
regulator of calcineurin 1
Mouse
5 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000105818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019466.2-225s1c1
Sequence:CCGGGCTTCAAACGTGTCCGGATAACTCGAGTTATCCGGACACGTTTGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105815    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019466.2-1388s1c1
Sequence:CCGGCCCAAGTAGAACTTAGCCTAACTCGAGTTAGGCTAAGTTCTACTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105816    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019466.2-450s1c1
Sequence:CCGGCCGTCATAAATTACGATCTTTCTCGAGAAAGATCGTAATTTATGACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019466.2-333s1c1
Sequence:CCGGCTCAGACTTTACACATAGGAACTCGAGTTCCTATGTGTAAAGTCTGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019466.2-112s1c1
Sequence:CCGGCCTGATTGCTTGTGTGGCAAACTCGAGTTTGCCACACAAGCAATCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004414
VALIDATED
RCAN1 MISSION shRNA Bacterial Glycerol Stock
regulator of calcineurin 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004414.5-339s1c1
Sequence:CCGGCCTCTTTAGGACGTATGACAACTCGAGTTGTCATACGTCCTAAAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_004414.5-532s1c1
Sequence:CCGGCCAAATCCAGACAAGCAGTTTCTCGAGAAACTGCTTGTCTGGATTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_004414.5-219s1c1
Sequence:CCGGGAGCTTCATTGACTGCGAGATCTCGAGATCTCGCAGTCAATGAAGCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_004414.5-709s1c1
Sequence:CCGGGTCCATGTATGTGAGAGTGATCTCGAGATCACTCTCACATACATGGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000019844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_004414.5-386s1c1
Sequence:CCGGGCTTCAAACGAGTCAGAATAACTCGAGTTATTCTGACTCGTTTGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000265773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004414.5-669s21c1
Sequence:CCGGTGAATTGCACGCAGCGACTGACTCGAGTCAGTCGCTGCGTGCAATTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004414.5-444s21c1
Sequence:CCGGCCAGCTGCATAAGACTGAGTTCTCGAGAACTCAGTCTTATGCAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004414.5-757s21c1
Sequence:CCGGGAAAGAATGAGGAGACCTAAGCTCGAGCTTAGGTCTCCTCATTCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004414.5-623s21c1
Sequence:CCGGATGATCTCTTATATGCCATCTCTCGAGAGATGGCATATAAGAGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004414.5-815s21c1
Sequence:CCGGCGATCCACCTCAGCTGAACTGCTCGAGCAGTTCAGCTGAGGTGGATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004414.5-583s21c1
Sequence:CCGGGGATGGAAACAAGTGGAAGATCTCGAGATCTTCCACTTGTTTCCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004414.5-2077s21c1
Sequence:CCGGGTCTGGTAAATAGGTATTATACTCGAGTATAATACCTATTTACCAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004414.5-1364s21c1
Sequence:CCGGACTAACCTTTGTTCGTATATACTCGAGTATATACGAACAAAGGTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004414.5-469s21c1
Sequence:CCGGGGAAAGGAAATGAAGTTATATCTCGAGATATAACTTCATTTCCTTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004414.5-491s21c1
Sequence:CCGGTTGCTCAGACCTTACACATAGCTCGAGCTATGTGTAAGGTCTGAGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004414
VALIDATED
RCAN1 MISSION shRNA shRNA Plasmid DNA
regulator of calcineurin 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004414.5-339s1c1
Sequence:CCGGCCTCTTTAGGACGTATGACAACTCGAGTTGTCATACGTCCTAAAGAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000019846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_004414.5-532s1c1
Sequence:CCGGCCAAATCCAGACAAGCAGTTTCTCGAGAAACTGCTTGTCTGGATTTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000019848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_004414.5-219s1c1
Sequence:CCGGGAGCTTCATTGACTGCGAGATCTCGAGATCTCGCAGTCAATGAAGCTCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000019847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_004414.5-709s1c1
Sequence:CCGGGTCCATGTATGTGAGAGTGATCTCGAGATCACTCTCACATACATGGACTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000019844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_004414.5-386s1c1
Sequence:CCGGGCTTCAAACGAGTCAGAATAACTCGAGTTATTCTGACTCGTTTGAAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000265773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004414.5-669s21c1
Sequence:CCGGTGAATTGCACGCAGCGACTGACTCGAGTCAGTCGCTGCGTGCAATTCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000256291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004414.5-444s21c1
Sequence:CCGGCCAGCTGCATAAGACTGAGTTCTCGAGAACTCAGTCTTATGCAGCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000256294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004414.5-757s21c1
Sequence:CCGGGAAAGAATGAGGAGACCTAAGCTCGAGCTTAGGTCTCCTCATTCTTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000256298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004414.5-623s21c1
Sequence:CCGGATGATCTCTTATATGCCATCTCTCGAGAGATGGCATATAAGAGATCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000256292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004414.5-815s21c1
Sequence:CCGGCGATCCACCTCAGCTGAACTGCTCGAGCAGTTCAGCTGAGGTGGATCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000256293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004414.5-583s21c1
Sequence:CCGGGGATGGAAACAAGTGGAAGATCTCGAGATCTTCCACTTGTTTCCATCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000256299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004414.5-2077s21c1
Sequence:CCGGGTCTGGTAAATAGGTATTATACTCGAGTATAATACCTATTTACCAGACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000256295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004414.5-1364s21c1
Sequence:CCGGACTAACCTTTGTTCGTATATACTCGAGTATATACGAACAAAGGTTAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000256297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004414.5-469s21c1
Sequence:CCGGGGAAAGGAAATGAAGTTATATCTCGAGATATAACTTCATTTCCTTTCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000256296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004414.5-491s21c1
Sequence:CCGGTTGCTCAGACCTTACACATAGCTCGAGCTATGTGTAAGGTCTGAGCAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004414
VALIDATED
RCAN1 MISSION shRNA Lentiviral Transduction Particles
regulator of calcineurin 1
Human
15 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000019845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004414.5-339s1c1
Sequence:CCGGCCTCTTTAGGACGTATGACAACTCGAGTTGTCATACGTCCTAAAGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_004414.5-532s1c1
Sequence:CCGGCCAAATCCAGACAAGCAGTTTCTCGAGAAACTGCTTGTCTGGATTTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_004414.5-219s1c1
Sequence:CCGGGAGCTTCATTGACTGCGAGATCTCGAGATCTCGCAGTCAATGAAGCTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_004414.5-709s1c1
Sequence:CCGGGTCCATGTATGTGAGAGTGATCTCGAGATCACTCTCACATACATGGACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000019844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_004414.5-386s1c1
Sequence:CCGGGCTTCAAACGAGTCAGAATAACTCGAGTTATTCTGACTCGTTTGAAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000265773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004414.5-669s21c1
Sequence:CCGGTGAATTGCACGCAGCGACTGACTCGAGTCAGTCGCTGCGTGCAATTCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004414.5-444s21c1
Sequence:CCGGCCAGCTGCATAAGACTGAGTTCTCGAGAACTCAGTCTTATGCAGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004414.5-757s21c1
Sequence:CCGGGAAAGAATGAGGAGACCTAAGCTCGAGCTTAGGTCTCCTCATTCTTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004414.5-623s21c1
Sequence:CCGGATGATCTCTTATATGCCATCTCTCGAGAGATGGCATATAAGAGATCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004414.5-815s21c1
Sequence:CCGGCGATCCACCTCAGCTGAACTGCTCGAGCAGTTCAGCTGAGGTGGATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004414.5-583s21c1
Sequence:CCGGGGATGGAAACAAGTGGAAGATCTCGAGATCTTCCACTTGTTTCCATCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256299    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004414.5-2077s21c1
Sequence:CCGGGTCTGGTAAATAGGTATTATACTCGAGTATAATACCTATTTACCAGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004414.5-1364s21c1
Sequence:CCGGACTAACCTTTGTTCGTATATACTCGAGTATATACGAACAAAGGTTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004414.5-469s21c1
Sequence:CCGGGGAAAGGAAATGAAGTTATATCTCGAGATATAACTTCATTTCCTTTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_004414.5-491s21c1
Sequence:CCGGTTGCTCAGACCTTACACATAGCTCGAGCTATGTGTAAGGTCTGAGCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)