EMAIL THIS PAGE TO A FRIEND

RCAN2

regulator of calcineurin 2

204 Gene Product Result for
Synonyms: CSP2 DSCR1L1 MCIP2 RCN2 ZAKI-4 ZAKI4
UniProtKB ID: Q14206, A6ND07, B3KR46, Q5VWF7, Q5VWF8, Q8N116
Gene ID:
Human(10231) Summary: This gene encodes a member of the regulator of calcineurin (RCAN) protein family. These proteins play a role in many physiological processes by binding to the catalytic domain of calcineurin A, inhibiting calcineurin-mediated nuclear translocation of the transcription factor NFATC1. Expression of this gene in skin fibroblasts is upregulated by thyroid hormone, and the encoded protein may also play a role in endothelial cell function and angiogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
Mouse(53901) regulator of calcineurin 2
Rat(140666) regulator of calcineurin 2
Zebrafish(407988) regulator of calcineurin 2
dog(609864) regulator of calcineurin 2
domestic cat(101099716) regulator of calcineurin 2
chicken(422057) regulator of calcineurin 2
naked mole-rat(101719934) regulator of calcineurin 2
domestic guinea pig(100728066) regulator of calcineurin 2
cow(525636) regulator of calcineurin 2
sheep(101120281) regulator of calcineurin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005822 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005822 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005822 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207649 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207649 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207649 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005822 Rosetta Predictions human pricing
NM_175578 Rosetta Predictions rat pricing
NM_030598 Rosetta Predictions mouse pricing
NM_207649 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005822 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340344 predicted 508
2 SASI_Hs01_00157400 predicted 1380
3 SASI_Hs01_00157402 predicted 1306
4 SASI_Hs01_00157399 predicted 383
5 SASI_Hs01_00157403 predicted 1278
6 SASI_Hs02_00340345 predicted 462
7 SASI_Hs01_00157406 predicted 1384
8 SASI_Hs02_00340346 predicted 1214
9 SASI_Hs01_00157407 predicted 1314
10 SASI_Hs02_00340347 predicted 420
11 SASI_Hs01_00157401 predicted 1177
12 SASI_Hs01_00157404 predicted 1252
13 SASI_Hs01_00157405 predicted 266
14 SASI_Hs01_00157408 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175578 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059266 predicted 814
2 SASI_Rn01_00059267 predicted 806
3 SASI_Rn01_00059268 predicted 1054
4 SASI_Rn01_00059269 predicted 842
5 SASI_Rn02_00269478 predicted 319
6 SASI_Rn01_00059271 predicted 496
7 SASI_Rn01_00059272 predicted 755
8 SASI_Rn01_00059273 predicted 597
9 SASI_Rn01_00059274 predicted 1021
10 SASI_Rn01_00059275 predicted 357
11 SASI_Rn01_00059270 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030598 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117173 predicted 1002
2 SASI_Mm01_00117174 predicted 457
3 SASI_Mm01_00117175 predicted 1100
4 SASI_Mm01_00117176 predicted 947
5 SASI_Mm01_00117177 predicted 1050
6 SASI_Mm01_00117178 predicted 476
7 SASI_Mm01_00117179 predicted 322
8 SASI_Mm01_00117180 predicted 1119
9 SASI_Mm01_00117181 predicted 360
10 SASI_Mm01_00117182 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207649 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109616 predicted 1132
2 SASI_Mm01_00109617 predicted 581
3 SASI_Mm01_00109618 predicted 1225
4 SASI_Mm01_00109619 predicted 1068
5 SASI_Mm01_00109620 predicted 1179
6 SASI_Mm01_00109621 predicted 610
7 SASI_Mm01_00109622 predicted 1272
8 SASI_Mm01_00109623 predicted 1246
9 SASI_Mm01_00109624 predicted 479
10 SASI_Mm01_00109625 predicted 1271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005822
RCAN2 MISSION shRNA Bacterial Glycerol Stock
regulator of calcineurin 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005822.2-365s21c1
Sequence:CCGGTGGTGGATGTCGAGGTCTTTACTCGAGTAAAGACCTCGACATCCACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005822.2-415s21c1
Sequence:CCGGGGACTGTTTCGGACTTATGATCTCGAGATCATAAGTCCGAAACAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147843    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005822.1-1159s1c1
Sequence:CCGGGCCACTTAAATAGGACCATATCTCGAGATATGGTCCTATTTAAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005822.1-349s1c1
Sequence:CCGGGTCCGTATAAACTTCAGCAATCTCGAGATTGCTGAAGTTTATACGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005822.1-385s1c1
Sequence:CCGGCGAGCTAGGATAGAGCTTCATCTCGAGATGAAGCTCTATCCTAGCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005822.1-244s1c1
Sequence:CCGGGATGTCGAGGTCTTTACCAATCTCGAGATTGGTAAAGACCTCGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005822.1-336s1c1
Sequence:CCGGGAGTTTCAGACGTGTCCGTATCTCGAGATACGGACACGTCTGAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005822.1-579s1c1
Sequence:CCGGCCTCAACTATGACCTCCTCTACTCGAGTAGAGGAGGTCATAGTTGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005822
RCAN2 MISSION shRNA shRNA Plasmid DNA
regulator of calcineurin 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005822.2-365s21c1
Sequence:CCGGTGGTGGATGTCGAGGTCTTTACTCGAGTAAAGACCTCGACATCCACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005822.2-415s21c1
Sequence:CCGGGGACTGTTTCGGACTTATGATCTCGAGATCATAAGTCCGAAACAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147843    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005822.1-1159s1c1
Sequence:CCGGGCCACTTAAATAGGACCATATCTCGAGATATGGTCCTATTTAAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005822.1-349s1c1
Sequence:CCGGGTCCGTATAAACTTCAGCAATCTCGAGATTGCTGAAGTTTATACGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005822.1-385s1c1
Sequence:CCGGCGAGCTAGGATAGAGCTTCATCTCGAGATGAAGCTCTATCCTAGCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005822.1-244s1c1
Sequence:CCGGGATGTCGAGGTCTTTACCAATCTCGAGATTGGTAAAGACCTCGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005822.1-336s1c1
Sequence:CCGGGAGTTTCAGACGTGTCCGTATCTCGAGATACGGACACGTCTGAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005822.1-579s1c1
Sequence:CCGGCCTCAACTATGACCTCCTCTACTCGAGTAGAGGAGGTCATAGTTGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005822
RCAN2 MISSION shRNA Lentiviral Transduction Particles
regulator of calcineurin 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432777    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005822.2-365s21c1
Sequence:CCGGTGGTGGATGTCGAGGTCTTTACTCGAGTAAAGACCTCGACATCCACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005822.2-415s21c1
Sequence:CCGGGGACTGTTTCGGACTTATGATCTCGAGATCATAAGTCCGAAACAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147843    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005822.1-1159s1c1
Sequence:CCGGGCCACTTAAATAGGACCATATCTCGAGATATGGTCCTATTTAAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005822.1-349s1c1
Sequence:CCGGGTCCGTATAAACTTCAGCAATCTCGAGATTGCTGAAGTTTATACGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005822.1-385s1c1
Sequence:CCGGCGAGCTAGGATAGAGCTTCATCTCGAGATGAAGCTCTATCCTAGCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179673    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005822.1-244s1c1
Sequence:CCGGGATGTCGAGGTCTTTACCAATCTCGAGATTGGTAAAGACCTCGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005822.1-336s1c1
Sequence:CCGGGAGTTTCAGACGTGTCCGTATCTCGAGATACGGACACGTCTGAAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005822.1-579s1c1
Sequence:CCGGCCTCAACTATGACCTCCTCTACTCGAGTAGAGGAGGTCATAGTTGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207649
VALIDATED
RCAN2 MISSION shRNA Bacterial Glycerol Stock
regulator of calcineurin 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000288090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207649.1-539s21c1
Sequence:CCGGCCGACGGGTTCGAATAAATTTCTCGAGAAATTTATTCGAACCCGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207649.1-294s21c1
Sequence:CCGGCAGGCATCTATCCCTGAAGATCTCGAGATCTTCAGGGATAGATGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207649.1-1151s21c1
Sequence:CCGGCAATCAACTCCTACCCATTAACTCGAGTTAATGGGTAGGAGTTGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207649.1-491s21c1
Sequence:CCGGGTTCCGGACCTATGATGAATGCTCGAGCATTCATCATAGGTCCGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207649.1-765s21c1
Sequence:CCGGGCCACACCAGTCCTCAACTATCTCGAGATAGTTGAGGACTGGTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207649.1-1949s1c1
Sequence:CCGGCCTGATACTATTACATGCTATCTCGAGATAGCATGTAATAGTATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207649.1-294s1c1
Sequence:CCGGCAGGCATCTATCCCTGAAGATCTCGAGATCTTCAGGGATAGATGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207649.1-765s1c1
Sequence:CCGGGCCACACCAGTCCTCAACTATCTCGAGATAGTTGAGGACTGGTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207649.1-539s1c1
Sequence:CCGGCCGACGGGTTCGAATAAATTTCTCGAGAAATTTATTCGAACCCGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207649
VALIDATED
RCAN2 MISSION shRNA shRNA Plasmid DNA
regulator of calcineurin 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000288090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207649.1-539s21c1
Sequence:CCGGCCGACGGGTTCGAATAAATTTCTCGAGAAATTTATTCGAACCCGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207649.1-294s21c1
Sequence:CCGGCAGGCATCTATCCCTGAAGATCTCGAGATCTTCAGGGATAGATGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207649.1-1151s21c1
Sequence:CCGGCAATCAACTCCTACCCATTAACTCGAGTTAATGGGTAGGAGTTGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207649.1-491s21c1
Sequence:CCGGGTTCCGGACCTATGATGAATGCTCGAGCATTCATCATAGGTCCGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207649.1-765s21c1
Sequence:CCGGGCCACACCAGTCCTCAACTATCTCGAGATAGTTGAGGACTGGTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207649.1-1949s1c1
Sequence:CCGGCCTGATACTATTACATGCTATCTCGAGATAGCATGTAATAGTATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207649.1-294s1c1
Sequence:CCGGCAGGCATCTATCCCTGAAGATCTCGAGATCTTCAGGGATAGATGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207649.1-765s1c1
Sequence:CCGGGCCACACCAGTCCTCAACTATCTCGAGATAGTTGAGGACTGGTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000105808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207649.1-539s1c1
Sequence:CCGGCCGACGGGTTCGAATAAATTTCTCGAGAAATTTATTCGAACCCGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207649
VALIDATED
RCAN2 MISSION shRNA Lentiviral Transduction Particles
regulator of calcineurin 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000288090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207649.1-539s21c1
Sequence:CCGGCCGACGGGTTCGAATAAATTTCTCGAGAAATTTATTCGAACCCGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207649.1-294s21c1
Sequence:CCGGCAGGCATCTATCCCTGAAGATCTCGAGATCTTCAGGGATAGATGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295473    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207649.1-1151s21c1
Sequence:CCGGCAATCAACTCCTACCCATTAACTCGAGTTAATGGGTAGGAGTTGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207649.1-491s21c1
Sequence:CCGGGTTCCGGACCTATGATGAATGCTCGAGCATTCATCATAGGTCCGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207649.1-765s21c1
Sequence:CCGGGCCACACCAGTCCTCAACTATCTCGAGATAGTTGAGGACTGGTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105805    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207649.1-1949s1c1
Sequence:CCGGCCTGATACTATTACATGCTATCTCGAGATAGCATGTAATAGTATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207649.1-294s1c1
Sequence:CCGGCAGGCATCTATCCCTGAAGATCTCGAGATCTTCAGGGATAGATGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207649.1-765s1c1
Sequence:CCGGGCCACACCAGTCCTCAACTATCTCGAGATAGTTGAGGACTGGTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000105808    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207649.1-539s1c1
Sequence:CCGGCCGACGGGTTCGAATAAATTTCTCGAGAAATTTATTCGAACCCGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)