EMAIL THIS PAGE TO A FRIEND

RCBTB1

regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1

108 Gene Product Result for
Synonyms: CLLD7 CLLL7 GLP RP11-185C18.1
UniProtKB ID: Q8NDN9, Q8IY29, Q969U9
Gene ID:
Human(55213) Summary: This gene encodes a protein with an N-terminal RCC1 domain and a C-terminal BTB (broad complex, tramtrack and bric-a-brac) domain. In rat, over-expression of this gene in vascular smooth muscle cells induced cellular hypertrophy. In rat, the C-terminus of RCBTB1 interacts with the angiotensin II receptor-1A. In humans, this gene maps to a region of chromosome 13q that is frequently deleted in B-cell chronic lymphocytic leukemia and other lymphoid malignancies. [provided by RefSeq, Jul 2008]
Mouse(71330) regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Rat(361050) regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Zebrafish(336007) regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
domestic cat(101093910) regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Horse(100056005) regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
dog(485440) regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
chicken(418868) regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
naked mole-rat(101724518) regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Domestic Rabbit(100337932) regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
domestic guinea pig(100720006) regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
cow(785222) regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
sheep(101116583) regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027764 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027764 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027764 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018191 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018191 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018191 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018191 Rosetta Predictions human pricing
NM_001108380 Rosetta Predictions rat pricing
XM_341330 Rosetta Predictions rat pricing
NM_027764 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018191 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205805 predicted 625
2 SASI_Hs01_00205806 predicted 1575
3 SASI_Hs01_00205807 predicted 429
4 SASI_Hs01_00205808 predicted 1718
5 SASI_Hs01_00205809 predicted 983
6 SASI_Hs01_00205810 predicted 1824
7 SASI_Hs01_00205811 predicted 1368
8 SASI_Hs01_00205812 predicted 1908
9 SASI_Hs01_00205813 predicted 1736
10 SASI_Hs02_00351460 predicted 495
11 SASI_Hs01_00205814 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108380 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238099 predicted 903
2 SASI_Rn02_00238100 predicted 1497
3 SASI_Rn02_00238101 predicted 411
4 SASI_Rn02_00238102 predicted 712
5 SASI_Rn02_00238103 predicted 1487
6 SASI_Rn02_00238104 predicted 552
7 SASI_Rn02_00238105 predicted 980
8 SASI_Rn02_00238106 predicted 1929
9 SASI_Rn02_00238107 predicted 873
10 SASI_Rn02_00238108 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00144854 predicted 1574
2 SASI_Rn01_00144855 predicted 1990
3 SASI_Rn01_00144856 predicted 1564
4 SASI_Rn01_00144857 predicted 1574
5 SASI_Rn01_00144858 predicted 1188
6 SASI_Rn01_00144859 predicted 2013
7 SASI_Rn01_00144860 predicted 1543
8 SASI_Rn01_00144861 predicted 1423
9 SASI_Rn01_00144862 predicted 1671
10 SASI_Rn01_00144863 predicted 1797
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027764 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111434 predicted 1108
2 SASI_Mm01_00111435 predicted 1574
3 SASI_Mm01_00111436 predicted 1621
4 SASI_Mm01_00111437 predicted 1857
5 SASI_Mm01_00111438 predicted 585
6 SASI_Mm01_00111439 predicted 502
7 SASI_Mm01_00111440 predicted 1611
8 SASI_Mm01_00111441 predicted 1964
9 SASI_Mm01_00111442 predicted 1016
10 SASI_Mm02_00332709 predicted 1506
11 SASI_Mm01_00111433 predicted 1554
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027764
VALIDATED
RCBTB1 MISSION shRNA Bacterial Glycerol Stock
regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027764.2-915s21c1
Sequence:CCGGCGGAAAGTTACAAACTGTTTACTCGAGTAAACAGTTTGTAACTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027764.2-1510s21c1
Sequence:CCGGCTGATCTAAAGTTTCGAATTGCTCGAGCAATTCGAAACTTTAGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027764.2-1783s21c1
Sequence:CCGGACATCATCAAGCGAGGAATTACTCGAGTAATTCCTCGCTTGATGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027764.2-753s21c1
Sequence:CCGGCCTGTCCAAGTCTGTACTAATCTCGAGATTAGTACAGACTTGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027764.2-2044s21c1
Sequence:CCGGTGCGGTGATCTGCAGGTAAAGCTCGAGCTTTACCTGCAGATCACCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027764.1-2978s1c1
Sequence:CCGGCCCTTCTTACAGGACTCCATACTCGAGTATGGAGTCCTGTAAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027764.1-969s1c1
Sequence:CCGGCGGAAAGTTACAAACTGTTTACTCGAGTAAACAGTTTGTAACTTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027764.1-2022s1c1
Sequence:CCGGGCCAGTAAATGTGGAGCCTTTCTCGAGAAAGGCTCCACATTTACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027764.1-807s1c1
Sequence:CCGGCCTGTCCAAGTCTGTACTAATCTCGAGATTAGTACAGACTTGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027764
VALIDATED
RCBTB1 MISSION shRNA shRNA Plasmid DNA
regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027764.2-915s21c1
Sequence:CCGGCGGAAAGTTACAAACTGTTTACTCGAGTAAACAGTTTGTAACTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027764.2-1510s21c1
Sequence:CCGGCTGATCTAAAGTTTCGAATTGCTCGAGCAATTCGAAACTTTAGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027764.2-1783s21c1
Sequence:CCGGACATCATCAAGCGAGGAATTACTCGAGTAATTCCTCGCTTGATGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027764.2-753s21c1
Sequence:CCGGCCTGTCCAAGTCTGTACTAATCTCGAGATTAGTACAGACTTGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027764.2-2044s21c1
Sequence:CCGGTGCGGTGATCTGCAGGTAAAGCTCGAGCTTTACCTGCAGATCACCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027764.1-2978s1c1
Sequence:CCGGCCCTTCTTACAGGACTCCATACTCGAGTATGGAGTCCTGTAAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027764.1-969s1c1
Sequence:CCGGCGGAAAGTTACAAACTGTTTACTCGAGTAAACAGTTTGTAACTTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027764.1-2022s1c1
Sequence:CCGGGCCAGTAAATGTGGAGCCTTTCTCGAGAAAGGCTCCACATTTACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027764.1-807s1c1
Sequence:CCGGCCTGTCCAAGTCTGTACTAATCTCGAGATTAGTACAGACTTGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027764
VALIDATED
RCBTB1 MISSION shRNA Lentiviral Transduction Particles
regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027764.2-915s21c1
Sequence:CCGGCGGAAAGTTACAAACTGTTTACTCGAGTAAACAGTTTGTAACTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027764.2-1510s21c1
Sequence:CCGGCTGATCTAAAGTTTCGAATTGCTCGAGCAATTCGAAACTTTAGATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027764.2-1783s21c1
Sequence:CCGGACATCATCAAGCGAGGAATTACTCGAGTAATTCCTCGCTTGATGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027764.2-753s21c1
Sequence:CCGGCCTGTCCAAGTCTGTACTAATCTCGAGATTAGTACAGACTTGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027764.2-2044s21c1
Sequence:CCGGTGCGGTGATCTGCAGGTAAAGCTCGAGCTTTACCTGCAGATCACCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110070    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027764.1-2978s1c1
Sequence:CCGGCCCTTCTTACAGGACTCCATACTCGAGTATGGAGTCCTGTAAGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027764.1-969s1c1
Sequence:CCGGCGGAAAGTTACAAACTGTTTACTCGAGTAAACAGTTTGTAACTTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027764.1-2022s1c1
Sequence:CCGGGCCAGTAAATGTGGAGCCTTTCTCGAGAAAGGCTCCACATTTACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027764.1-807s1c1
Sequence:CCGGCCTGTCCAAGTCTGTACTAATCTCGAGATTAGTACAGACTTGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018191
VALIDATED
RCBTB1 MISSION shRNA Bacterial Glycerol Stock
regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018191.3-361s21c1
Sequence:CCGGGCACTGTACGTTACTGACAATCTCGAGATTGTCAGTAACGTACAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018191.3-304s21c1
Sequence:CCGGCCTCAAGAGATCGCGTCTATTCTCGAGAATAGACGCGATCTCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018191.3-850s21c1
Sequence:CCGGCTGGACAATGGCGAGGTATATCTCGAGATATACCTCGCCATTGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018191.3-2343s21c1
Sequence:CCGGCCTTACTGTGAAGGAATAATTCTCGAGAATTATTCCTTCACAGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018191.3-470s21c1
Sequence:CCGGGCTTATGTGGAAAGAAGATTACTCGAGTAATCTTCTTTCCACATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018191.2-592s1c1
Sequence:CCGGCCAGGTCTGTACCAATCTCTTCTCGAGAAGAGATTGGTACAGACCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018191.2-824s1c1
Sequence:CCGGCTGGACAATGGCGAGGTATATCTCGAGATATACCTCGCCATTGTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018191.2-412s1c1
Sequence:CCGGCCAGAGTACACTTGTACCCAACTCGAGTTGGGTACAAGTGTACTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018191.2-327s1c1
Sequence:CCGGCCAGTGAAGCACTGTACGTTACTCGAGTAACGTACAGTGCTTCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018191.2-335s1c1
Sequence:CCGGGCACTGTACGTTACTGACAATCTCGAGATTGTCAGTAACGTACAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160987    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018191.2-3207s1c1
Sequence:CCGGGCCAAATTACAAGTGGGTGAACTCGAGTTCACCCACTTGTAATTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159891    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018191.2-3324s1c1
Sequence:CCGGGCTGAAATAGATACAAGCCTACTCGAGTAGGCTTGTATCTATTTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018191.2-1448s1c1
Sequence:CCGGGAAGACATGAAGGAAGTGATACTCGAGTATCACTTCCTTCATGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018191.2-444s1c1
Sequence:CCGGGCTTATGTGGAAAGAAGATTACTCGAGTAATCTTCTTTCCACATAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018191
VALIDATED
RCBTB1 MISSION shRNA shRNA Plasmid DNA
regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018191.3-361s21c1
Sequence:CCGGGCACTGTACGTTACTGACAATCTCGAGATTGTCAGTAACGTACAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018191.3-304s21c1
Sequence:CCGGCCTCAAGAGATCGCGTCTATTCTCGAGAATAGACGCGATCTCTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018191.3-850s21c1
Sequence:CCGGCTGGACAATGGCGAGGTATATCTCGAGATATACCTCGCCATTGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018191.3-2343s21c1
Sequence:CCGGCCTTACTGTGAAGGAATAATTCTCGAGAATTATTCCTTCACAGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018191.3-470s21c1
Sequence:CCGGGCTTATGTGGAAAGAAGATTACTCGAGTAATCTTCTTTCCACATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018191.2-592s1c1
Sequence:CCGGCCAGGTCTGTACCAATCTCTTCTCGAGAAGAGATTGGTACAGACCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018191.2-824s1c1
Sequence:CCGGCTGGACAATGGCGAGGTATATCTCGAGATATACCTCGCCATTGTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018191.2-412s1c1
Sequence:CCGGCCAGAGTACACTTGTACCCAACTCGAGTTGGGTACAAGTGTACTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018191.2-327s1c1
Sequence:CCGGCCAGTGAAGCACTGTACGTTACTCGAGTAACGTACAGTGCTTCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018191.2-335s1c1
Sequence:CCGGGCACTGTACGTTACTGACAATCTCGAGATTGTCAGTAACGTACAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160987    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018191.2-3207s1c1
Sequence:CCGGGCCAAATTACAAGTGGGTGAACTCGAGTTCACCCACTTGTAATTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159891    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018191.2-3324s1c1
Sequence:CCGGGCTGAAATAGATACAAGCCTACTCGAGTAGGCTTGTATCTATTTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018191.2-1448s1c1
Sequence:CCGGGAAGACATGAAGGAAGTGATACTCGAGTATCACTTCCTTCATGTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018191.2-444s1c1
Sequence:CCGGGCTTATGTGGAAAGAAGATTACTCGAGTAATCTTCTTTCCACATAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018191
VALIDATED
RCBTB1 MISSION shRNA Lentiviral Transduction Particles
regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018191.3-361s21c1
Sequence:CCGGGCACTGTACGTTACTGACAATCTCGAGATTGTCAGTAACGTACAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018191.3-304s21c1
Sequence:CCGGCCTCAAGAGATCGCGTCTATTCTCGAGAATAGACGCGATCTCTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018191.3-850s21c1
Sequence:CCGGCTGGACAATGGCGAGGTATATCTCGAGATATACCTCGCCATTGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018191.3-2343s21c1
Sequence:CCGGCCTTACTGTGAAGGAATAATTCTCGAGAATTATTCCTTCACAGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_018191.3-470s21c1
Sequence:CCGGGCTTATGTGGAAAGAAGATTACTCGAGTAATCTTCTTTCCACATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018191.2-592s1c1
Sequence:CCGGCCAGGTCTGTACCAATCTCTTCTCGAGAAGAGATTGGTACAGACCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018191.2-824s1c1
Sequence:CCGGCTGGACAATGGCGAGGTATATCTCGAGATATACCTCGCCATTGTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018191.2-412s1c1
Sequence:CCGGCCAGAGTACACTTGTACCCAACTCGAGTTGGGTACAAGTGTACTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164162    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018191.2-327s1c1
Sequence:CCGGCCAGTGAAGCACTGTACGTTACTCGAGTAACGTACAGTGCTTCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161872    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018191.2-335s1c1
Sequence:CCGGGCACTGTACGTTACTGACAATCTCGAGATTGTCAGTAACGTACAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160987    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018191.2-3207s1c1
Sequence:CCGGGCCAAATTACAAGTGGGTGAACTCGAGTTCACCCACTTGTAATTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159891    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018191.2-3324s1c1
Sequence:CCGGGCTGAAATAGATACAAGCCTACTCGAGTAGGCTTGTATCTATTTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018191.2-1448s1c1
Sequence:CCGGGAAGACATGAAGGAAGTGATACTCGAGTATCACTTCCTTCATGTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018191.2-444s1c1
Sequence:CCGGGCTTATGTGGAAAGAAGATTACTCGAGTAATCTTCTTTCCACATAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)