EMAIL THIS PAGE TO A FRIEND

RCC1

regulator of chromosome condensation 1

101 Gene Product Result for
Synonyms: CHC1 RCC1-I SNHG3-RCC1
UniProtKB ID: P18754, Q16269, Q6NT97
Gene ID:
Mouse(100088) regulator of chromosome condensation 1
Rat(682908) regulator of chromosome condensation 1
Zebrafish(406457) regulator of chromosome condensation 1
chicken(429810) regulator of chromosome condensation 1
domestic cat(101087078) regulator of chromosome condensation 1
Horse(100070733) regulator of chromosome condensation 1
dog(487332) regulator of chromosome condensation 1
naked mole-rat(101717307) regulator of chromosome condensation 1
Domestic Rabbit(100352855) regulator of chromosome condensation 1
domestic guinea pig(100719046) regulator of chromosome condensation 1
cow(534142) regulator of chromosome condensation 1
sheep(101102961) regulator of chromosome condensation 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
R6907 Anti-RCC1 (371-382) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
R6782 Anti-RCC1 (98-110) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4200276 Anti-RCC1 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB4200277 Anti-RCC1 (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1405611 Anti-RCC1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA027573 Anti-RCC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 Antibody Enhanced Validation mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
HPA027574 Anti-RCC1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 Antibody Enhanced Validation human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
WH0001104M1 Monoclonal Anti-RCC1 antibody produced in mouse clone 2F1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1403666 Monoclonal Anti-RCC1, (C-terminal) antibody produced in mouse clone 1C1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunoprecipitation (IP), western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133878 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133878 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133878 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001269 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001269 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001269 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001048194 Rosetta Predictions human pricing
NM_001048195 Rosetta Predictions human pricing
NM_001269 Rosetta Predictions human pricing
NM_001128189 Rosetta Predictions rat pricing
NM_133878 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311612 predicted 893
2 SASI_Hs02_00311613 predicted 1870
3 SASI_Hs02_00311614 predicted 1686
4 SASI_Hs02_00311615 predicted 1398
5 SASI_Hs02_00311616 predicted 1082
6 SASI_Hs02_00311617 predicted 1029
7 SASI_Hs02_00311618 predicted 1687
8 SASI_Hs02_00311619 predicted 707
9 SASI_Hs02_00311620 predicted 1409
10 SASI_Hs02_00311621 predicted 1355
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311622 predicted 854
2 SASI_Hs02_00311623 predicted 1830
3 SASI_Hs02_00311624 predicted 1648
4 SASI_Hs02_00311625 predicted 1354
5 SASI_Hs02_00311626 predicted 1042
6 SASI_Hs02_00311627 predicted 989
7 SASI_Hs02_00311628 predicted 1639
8 SASI_Hs02_00311629 predicted 672
9 SASI_Hs02_00311630 predicted 1364
10 SASI_Hs02_00311631 predicted 1313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040220 predicted 803
2 SASI_Hs02_00331470 predicted 1777
3 SASI_Hs01_00040221 predicted 1596
4 SASI_Hs01_00040222 predicted 1307
5 SASI_Hs01_00040223 predicted 997
6 SASI_Hs01_00040225 predicted 934
7 SASI_Hs01_00040226 predicted 1590
8 SASI_Hs01_00040227 predicted 616
9 SASI_Hs01_00040228 predicted 1316
10 SASI_Hs02_00331471 predicted 1254
11 SASI_Hs01_00040219 predicted 1140
12 SASI_Hs01_00040224 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128189 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255070 predicted 887
2 SASI_Rn02_00255071 predicted 496
3 SASI_Rn02_00255072 predicted 1072
4 SASI_Rn02_00255073 predicted 256
5 SASI_Rn02_00255074 predicted 1235
6 SASI_Rn02_00255075 predicted 943
7 SASI_Rn02_00255076 predicted 387
8 SASI_Rn02_00255077 predicted 903
9 SASI_Rn02_00255078 predicted 720
10 SASI_Rn02_00255079 predicted 706
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121510 predicted 452
2 SASI_Mm01_00121511 predicted 1367
3 SASI_Mm01_00121512 predicted 1372
4 SASI_Mm01_00121513 predicted 454
5 SASI_Mm02_00338934 predicted 328
6 SASI_Mm01_00121514 predicted 1360
7 SASI_Mm01_00121516 predicted 1222
8 SASI_Mm01_00121517 predicted 1352
9 SASI_Mm01_00121518 predicted 281
10 SASI_Mm01_00121519 predicted 1162
11 SASI_Mm01_00121515 predicted 860
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133878
VALIDATED
RCC1 MISSION shRNA Bacterial Glycerol Stock
regulator of chromosome condensation 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133878.2-758s21c1
Sequence:CCGGTGCCTTCTGTGGCGCCTATTTCTCGAGAAATAGGCGCCACAGAAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133878.2-1188s21c1
Sequence:CCGGCCTGTGGAAATGACTGGCAAACTCGAGTTTGCCAGTCATTTCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133878.2-1253s21c1
Sequence:CCGGGCACACGGTCTTACTAGTTAACTCGAGTTAACTAGTAAGACCGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133878.2-1690s21c1
Sequence:CCGGCGAGCCTCTTTCTGTTCCTAACTCGAGTTAGGAACAGAAAGAGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133878.2-334s21c1
Sequence:CCGGCTTCAGTCGAAGGCTCAGAAACTCGAGTTTCTGAGCCTTCGACTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133878.1-648s1c1
Sequence:CCGGCCTGAATTATTTGCCAACCGACTCGAGTCGGTTGGCAAATAATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133878.1-1690s1c1
Sequence:CCGGCGAGCCTCTTTCTGTTCCTAACTCGAGTTAGGAACAGAAAGAGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133878.1-334s1c1
Sequence:CCGGCTTCAGTCGAAGGCTCAGAAACTCGAGTTTCTGAGCCTTCGACTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133878.1-1253s1c1
Sequence:CCGGGCACACGGTCTTACTAGTTAACTCGAGTTAACTAGTAAGACCGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133878.1-1188s1c1
Sequence:CCGGCCTGTGGAAATGACTGGCAAACTCGAGTTTGCCAGTCATTTCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133878
VALIDATED
RCC1 MISSION shRNA shRNA Plasmid DNA
regulator of chromosome condensation 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133878.2-758s21c1
Sequence:CCGGTGCCTTCTGTGGCGCCTATTTCTCGAGAAATAGGCGCCACAGAAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133878.2-1188s21c1
Sequence:CCGGCCTGTGGAAATGACTGGCAAACTCGAGTTTGCCAGTCATTTCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133878.2-1253s21c1
Sequence:CCGGGCACACGGTCTTACTAGTTAACTCGAGTTAACTAGTAAGACCGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133878.2-1690s21c1
Sequence:CCGGCGAGCCTCTTTCTGTTCCTAACTCGAGTTAGGAACAGAAAGAGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133878.2-334s21c1
Sequence:CCGGCTTCAGTCGAAGGCTCAGAAACTCGAGTTTCTGAGCCTTCGACTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133878.1-648s1c1
Sequence:CCGGCCTGAATTATTTGCCAACCGACTCGAGTCGGTTGGCAAATAATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133878.1-1690s1c1
Sequence:CCGGCGAGCCTCTTTCTGTTCCTAACTCGAGTTAGGAACAGAAAGAGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133878.1-334s1c1
Sequence:CCGGCTTCAGTCGAAGGCTCAGAAACTCGAGTTTCTGAGCCTTCGACTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133878.1-1253s1c1
Sequence:CCGGGCACACGGTCTTACTAGTTAACTCGAGTTAACTAGTAAGACCGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133878.1-1188s1c1
Sequence:CCGGCCTGTGGAAATGACTGGCAAACTCGAGTTTGCCAGTCATTTCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133878
VALIDATED
RCC1 MISSION shRNA Lentiviral Transduction Particles
regulator of chromosome condensation 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133878.2-758s21c1
Sequence:CCGGTGCCTTCTGTGGCGCCTATTTCTCGAGAAATAGGCGCCACAGAAGGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133878.2-1188s21c1
Sequence:CCGGCCTGTGGAAATGACTGGCAAACTCGAGTTTGCCAGTCATTTCCACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133878.2-1253s21c1
Sequence:CCGGGCACACGGTCTTACTAGTTAACTCGAGTTAACTAGTAAGACCGTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133878.2-1690s21c1
Sequence:CCGGCGAGCCTCTTTCTGTTCCTAACTCGAGTTAGGAACAGAAAGAGGCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133878.2-334s21c1
Sequence:CCGGCTTCAGTCGAAGGCTCAGAAACTCGAGTTTCTGAGCCTTCGACTGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133878.1-648s1c1
Sequence:CCGGCCTGAATTATTTGCCAACCGACTCGAGTCGGTTGGCAAATAATTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133878.1-1690s1c1
Sequence:CCGGCGAGCCTCTTTCTGTTCCTAACTCGAGTTAGGAACAGAAAGAGGCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133878.1-334s1c1
Sequence:CCGGCTTCAGTCGAAGGCTCAGAAACTCGAGTTTCTGAGCCTTCGACTGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133878.1-1253s1c1
Sequence:CCGGGCACACGGTCTTACTAGTTAACTCGAGTTAACTAGTAAGACCGTGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133878.1-1188s1c1
Sequence:CCGGCCTGTGGAAATGACTGGCAAACTCGAGTTTGCCAGTCATTTCCACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001269
VALIDATED
RCC1 MISSION shRNA Bacterial Glycerol Stock
regulator of chromosome condensation 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000157754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-1785s1c1
Sequence:CCGGCATGGCTCACTCAGAGCTATACTCGAGTATAGCTCTGAGTGAGCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-548s1c1
Sequence:CCGGGTCTATTCCTTCGGCTGCAATCTCGAGATTGCAGCCGAAGGAATAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-1004s1c1
Sequence:CCGGGTGAGATTCCAGGATGCCTTTCTCGAGAAAGGCATCCTGGAATCTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001269.2-1982s1c1
Sequence:CCGGGCAAACAAATGGTACAGTCATCTCGAGATGACTGTACCATTTGTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-1135s1c1
Sequence:CCGGCCAGAACCTAACATCCTTCAACTCGAGTTGAAGGATGTTAGGTTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-1855s1c1
Sequence:CCGGCCTGGCTTTGCCTACTAGAAACTCGAGTTTCTAGTAGGCAAAGCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001269.2-725s1c1
Sequence:CCGGCGGGACAATAACGGTGTGATTCTCGAGAATCACACCGTTATTGTCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-962s1c1
Sequence:CCGGCCCAAGTGTGTGATGCTGAAACTCGAGTTTCAGCATCACACACTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-1086s1c1
Sequence:CCGGCCAACTACCATCAGCTTGGAACTCGAGTTCCAAGCTGATGGTAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-1207s1c1
Sequence:CCGGCTGCATGGATTCGGAAGGAAACTCGAGTTTCCTTCCGAATCCATGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001269
VALIDATED
RCC1 MISSION shRNA shRNA Plasmid DNA
regulator of chromosome condensation 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000157754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-1785s1c1
Sequence:CCGGCATGGCTCACTCAGAGCTATACTCGAGTATAGCTCTGAGTGAGCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-548s1c1
Sequence:CCGGGTCTATTCCTTCGGCTGCAATCTCGAGATTGCAGCCGAAGGAATAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-1004s1c1
Sequence:CCGGGTGAGATTCCAGGATGCCTTTCTCGAGAAAGGCATCCTGGAATCTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001269.2-1982s1c1
Sequence:CCGGGCAAACAAATGGTACAGTCATCTCGAGATGACTGTACCATTTGTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-1135s1c1
Sequence:CCGGCCAGAACCTAACATCCTTCAACTCGAGTTGAAGGATGTTAGGTTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-1855s1c1
Sequence:CCGGCCTGGCTTTGCCTACTAGAAACTCGAGTTTCTAGTAGGCAAAGCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001269.2-725s1c1
Sequence:CCGGCGGGACAATAACGGTGTGATTCTCGAGAATCACACCGTTATTGTCCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-962s1c1
Sequence:CCGGCCCAAGTGTGTGATGCTGAAACTCGAGTTTCAGCATCACACACTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-1086s1c1
Sequence:CCGGCCAACTACCATCAGCTTGGAACTCGAGTTCCAAGCTGATGGTAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-1207s1c1
Sequence:CCGGCTGCATGGATTCGGAAGGAAACTCGAGTTTCCTTCCGAATCCATGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001269
VALIDATED
RCC1 MISSION shRNA Lentiviral Transduction Particles
regulator of chromosome condensation 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000157754    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-1785s1c1
Sequence:CCGGCATGGCTCACTCAGAGCTATACTCGAGTATAGCTCTGAGTGAGCCATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-548s1c1
Sequence:CCGGGTCTATTCCTTCGGCTGCAATCTCGAGATTGCAGCCGAAGGAATAGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-1004s1c1
Sequence:CCGGGTGAGATTCCAGGATGCCTTTCTCGAGAAAGGCATCCTGGAATCTCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151199    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001269.2-1982s1c1
Sequence:CCGGGCAAACAAATGGTACAGTCATCTCGAGATGACTGTACCATTTGTTTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-1135s1c1
Sequence:CCGGCCAGAACCTAACATCCTTCAACTCGAGTTGAAGGATGTTAGGTTCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157236    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-1855s1c1
Sequence:CCGGCCTGGCTTTGCCTACTAGAAACTCGAGTTTCTAGTAGGCAAAGCCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001269.2-725s1c1
Sequence:CCGGCGGGACAATAACGGTGTGATTCTCGAGAATCACACCGTTATTGTCCCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-962s1c1
Sequence:CCGGCCCAAGTGTGTGATGCTGAAACTCGAGTTTCAGCATCACACACTTGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-1086s1c1
Sequence:CCGGCCAACTACCATCAGCTTGGAACTCGAGTTCCAAGCTGATGGTAGTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001269.2-1207s1c1
Sequence:CCGGCTGCATGGATTCGGAAGGAAACTCGAGTTTCCTTCCGAATCCATGCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)