EMAIL THIS PAGE TO A FRIEND

RCC2

regulator of chromosome condensation 2

119 Gene Product Result for
Synonyms: TD-60
UniProtKB ID: Q9P258, Q8IVL9, Q9BSN6, Q9NPV8
Gene ID:
Mouse(108911) regulator of chromosome condensation 2
Rat(298594) regulator of chromosome condensation 2
cow(509120) regulator of chromosome condensation 2
sheep(101107424) regulator of chromosome condensation 2
naked mole-rat(101723469) regulator of chromosome condensation 2
Zebrafish(406455) regulator of chromosome condensation 2
chicken(419361) regulator of chromosome condensation 2
domestic cat(101086736) regulator of chromosome condensation 2
dog(487412) regulator of chromosome condensation 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0109 AQUA Peptide DGQILPVPNVVV[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing
AQ0050 AQUA Peptide LFDFPG[R] African clawed frog, chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173867 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173867 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173867 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018715 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018715 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018715 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018715 Rosetta Predictions human pricing
XM_001072061 Rosetta Predictions rat pricing
XM_216557 Rosetta Predictions rat pricing
NM_173867 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352252 predicted 834
2 SASI_Hs01_00218429 predicted 1714
3 SASI_Hs01_00218430 predicted 1187
4 SASI_Hs01_00218431 predicted 1134
5 SASI_Hs01_00218433 predicted 1040
6 SASI_Hs01_00218435 predicted 821
7 SASI_Hs02_00352253 predicted 866
8 SASI_Hs01_00218436 predicted 1471
9 SASI_Hs01_00218437 predicted 1203
10 SASI_Hs02_00352254 predicted 1461
11 SASI_Hs01_00218432 predicted 1090
12 SASI_Hs01_00218434 predicted 1711
13 SASI_Hs01_00218438 predicted 826
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072061 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337617 predicted 972
2 SASI_Rn02_00337618 predicted 1125
3 SASI_Rn02_00337619 predicted 363
4 SASI_Rn02_00337620 predicted 391
5 SASI_Rn02_00337621 predicted 583
6 SASI_Rn02_00337622 predicted 529
7 SASI_Rn02_00337623 predicted 460
8 SASI_Rn02_00337624 predicted 317
9 SASI_Rn02_00337625 predicted 358
10 SASI_Rn02_00337626 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216557 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376670 predicted 975
2 SASI_Rn02_00376671 predicted 1127
3 SASI_Rn02_00376672 predicted 364
4 SASI_Rn02_00376673 predicted 391
5 SASI_Rn02_00376674 predicted 590
6 SASI_Rn02_00376675 predicted 531
7 SASI_Rn02_00376676 predicted 460
8 SASI_Rn02_00376677 predicted 319
9 SASI_Rn02_00376678 predicted 358
10 SASI_Rn02_00376679 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173867 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121261 predicted 769
2 SASI_Mm01_00121262 predicted 453
3 SASI_Mm01_00121263 predicted 1504
4 SASI_Mm01_00121264 predicted 834
5 SASI_Mm01_00121265 predicted 494
6 SASI_Mm01_00121266 predicted 1110
7 SASI_Mm01_00121267 predicted 901
8 SASI_Mm01_00121268 predicted 1062
9 SASI_Mm01_00121269 predicted 436
10 SASI_Mm01_00121270 predicted 1105
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173867
VALIDATED
RCC2 MISSION shRNA Bacterial Glycerol Stock
regulator of chromosome condensation 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000176107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173867.1-914s1c1
Sequence:CCGGGCTGATGGACTGTAAAGGAAACTCGAGTTTCCTTTACAGTCCATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173867.1-1589s1c1
Sequence:CCGGCTATTCACACTCCTTGGTGATCTCGAGATCACCAAGGAGTGTGAATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173356    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173867.1-1731s1c1
Sequence:CCGGGACCAGAAGTCAGACAAGGAACTCGAGTTCCTTGTCTGACTTCTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173867.1-780s1c1
Sequence:CCGGGTGTTTGCCTTCGGAGAGAATCTCGAGATTCTCTCCGAAGGCAAACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173867.1-977s1c1
Sequence:CCGGCAACTCAGATGGCAAGTTCATCTCGAGATGAACTTGCCATCTGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173867.4-977s21c1
Sequence:CCGGCAACTCAGATGGCAAGTTCATCTCGAGATGAACTTGCCATCTGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173867.4-1731s21c1
Sequence:CCGGGACCAGAAGTCAGACAAGGAACTCGAGTTCCTTGTCTGACTTCTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173867.4-780s21c1
Sequence:CCGGGTGTTTGCCTTCGGAGAGAATCTCGAGATTCTCTCCGAAGGCAAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173867.4-914s21c1
Sequence:CCGGGCTGATGGACTGTAAAGGAAACTCGAGTTTCCTTTACAGTCCATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173867.4-1589s21c1
Sequence:CCGGCTATTCACACTCCTTGGTGATCTCGAGATCACCAAGGAGTGTGAATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173867
VALIDATED
RCC2 MISSION shRNA shRNA Plasmid DNA
regulator of chromosome condensation 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000176107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173867.1-914s1c1
Sequence:CCGGGCTGATGGACTGTAAAGGAAACTCGAGTTTCCTTTACAGTCCATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173867.1-1589s1c1
Sequence:CCGGCTATTCACACTCCTTGGTGATCTCGAGATCACCAAGGAGTGTGAATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173356    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173867.1-1731s1c1
Sequence:CCGGGACCAGAAGTCAGACAAGGAACTCGAGTTCCTTGTCTGACTTCTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173867.1-780s1c1
Sequence:CCGGGTGTTTGCCTTCGGAGAGAATCTCGAGATTCTCTCCGAAGGCAAACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173867.1-977s1c1
Sequence:CCGGCAACTCAGATGGCAAGTTCATCTCGAGATGAACTTGCCATCTGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173867.4-977s21c1
Sequence:CCGGCAACTCAGATGGCAAGTTCATCTCGAGATGAACTTGCCATCTGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173867.4-1731s21c1
Sequence:CCGGGACCAGAAGTCAGACAAGGAACTCGAGTTCCTTGTCTGACTTCTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173867.4-780s21c1
Sequence:CCGGGTGTTTGCCTTCGGAGAGAATCTCGAGATTCTCTCCGAAGGCAAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173867.4-914s21c1
Sequence:CCGGGCTGATGGACTGTAAAGGAAACTCGAGTTTCCTTTACAGTCCATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173867.4-1589s21c1
Sequence:CCGGCTATTCACACTCCTTGGTGATCTCGAGATCACCAAGGAGTGTGAATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173867
VALIDATED
RCC2 MISSION shRNA Lentiviral Transduction Particles
regulator of chromosome condensation 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000176107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173867.1-914s1c1
Sequence:CCGGGCTGATGGACTGTAAAGGAAACTCGAGTTTCCTTTACAGTCCATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173867.1-1589s1c1
Sequence:CCGGCTATTCACACTCCTTGGTGATCTCGAGATCACCAAGGAGTGTGAATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173356    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173867.1-1731s1c1
Sequence:CCGGGACCAGAAGTCAGACAAGGAACTCGAGTTCCTTGTCTGACTTCTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173867.1-780s1c1
Sequence:CCGGGTGTTTGCCTTCGGAGAGAATCTCGAGATTCTCTCCGAAGGCAAACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173867.1-977s1c1
Sequence:CCGGCAACTCAGATGGCAAGTTCATCTCGAGATGAACTTGCCATCTGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173867.4-977s21c1
Sequence:CCGGCAACTCAGATGGCAAGTTCATCTCGAGATGAACTTGCCATCTGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173867.4-1731s21c1
Sequence:CCGGGACCAGAAGTCAGACAAGGAACTCGAGTTCCTTGTCTGACTTCTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173867.4-780s21c1
Sequence:CCGGGTGTTTGCCTTCGGAGAGAATCTCGAGATTCTCTCCGAAGGCAAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173867.4-914s21c1
Sequence:CCGGGCTGATGGACTGTAAAGGAAACTCGAGTTTCCTTTACAGTCCATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173867.4-1589s21c1
Sequence:CCGGCTATTCACACTCCTTGGTGATCTCGAGATCACCAAGGAGTGTGAATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018715
VALIDATED
RCC2 MISSION shRNA Bacterial Glycerol Stock
regulator of chromosome condensation 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018715.1-516s1c1
Sequence:CCGGGCGTCAAACTTGAAGGGTCAACTCGAGTTGACCCTTCAAGTTTGACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018715.1-3396s1c1
Sequence:CCGGGCGCATCTCTTGTTCTGTGTTCTCGAGAACACAGAACAAGAGATGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018715.1-1099s1c1
Sequence:CCGGCAACTCAGATGGGAAGTTCATCTCGAGATGAACTTCCCATCTGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018715.1-2068s1c1
Sequence:CCGGGCAGAAACTTTGAGCAATCTACTCGAGTAGATTGCTCAAAGTTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018715.1-1750s1c1
Sequence:CCGGGACTGAGAAAGAGAAGATCAACTCGAGTTGATCTTCTCTTTCTCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018715.2-1420s21c1
Sequence:CCGGCCAACACCTCCCGTGAATCTACTCGAGTAGATTCACGGGAGGTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018715.2-1141s21c1
Sequence:CCGGAGACGAAAGATGGACAGATTCCTCGAGGAATCTGTCCATCTTTCGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018715.2-1679s21c1
Sequence:CCGGGGTGATAGCAAGAGATGAAAGCTCGAGCTTTCATCTCTTGCTATCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018715.2-1982s21c1
Sequence:CCGGATACTTGCTCATAGTTGATTTCTCGAGAAATCAACTATGAGCAAGTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018715.2-520s21c1
Sequence:CCGGCAACCAACTGGGACTTGATTGCTCGAGCAATCAAGTCCCAGTTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018715
VALIDATED
RCC2 MISSION shRNA shRNA Plasmid DNA
regulator of chromosome condensation 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018715.1-516s1c1
Sequence:CCGGGCGTCAAACTTGAAGGGTCAACTCGAGTTGACCCTTCAAGTTTGACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018715.1-3396s1c1
Sequence:CCGGGCGCATCTCTTGTTCTGTGTTCTCGAGAACACAGAACAAGAGATGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018715.1-1099s1c1
Sequence:CCGGCAACTCAGATGGGAAGTTCATCTCGAGATGAACTTCCCATCTGAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018715.1-2068s1c1
Sequence:CCGGGCAGAAACTTTGAGCAATCTACTCGAGTAGATTGCTCAAAGTTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018715.1-1750s1c1
Sequence:CCGGGACTGAGAAAGAGAAGATCAACTCGAGTTGATCTTCTCTTTCTCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018715.2-1420s21c1
Sequence:CCGGCCAACACCTCCCGTGAATCTACTCGAGTAGATTCACGGGAGGTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018715.2-1141s21c1
Sequence:CCGGAGACGAAAGATGGACAGATTCCTCGAGGAATCTGTCCATCTTTCGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018715.2-1679s21c1
Sequence:CCGGGGTGATAGCAAGAGATGAAAGCTCGAGCTTTCATCTCTTGCTATCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018715.2-1982s21c1
Sequence:CCGGATACTTGCTCATAGTTGATTTCTCGAGAAATCAACTATGAGCAAGTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018715.2-520s21c1
Sequence:CCGGCAACCAACTGGGACTTGATTGCTCGAGCAATCAAGTCCCAGTTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018715
VALIDATED
RCC2 MISSION shRNA Lentiviral Transduction Particles
regulator of chromosome condensation 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018715.1-516s1c1
Sequence:CCGGGCGTCAAACTTGAAGGGTCAACTCGAGTTGACCCTTCAAGTTTGACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018715.1-3396s1c1
Sequence:CCGGGCGCATCTCTTGTTCTGTGTTCTCGAGAACACAGAACAAGAGATGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018715.1-1099s1c1
Sequence:CCGGCAACTCAGATGGGAAGTTCATCTCGAGATGAACTTCCCATCTGAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018715.1-2068s1c1
Sequence:CCGGGCAGAAACTTTGAGCAATCTACTCGAGTAGATTGCTCAAAGTTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018715.1-1750s1c1
Sequence:CCGGGACTGAGAAAGAGAAGATCAACTCGAGTTGATCTTCTCTTTCTCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018715.2-1420s21c1
Sequence:CCGGCCAACACCTCCCGTGAATCTACTCGAGTAGATTCACGGGAGGTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018715.2-1141s21c1
Sequence:CCGGAGACGAAAGATGGACAGATTCCTCGAGGAATCTGTCCATCTTTCGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018715.2-1679s21c1
Sequence:CCGGGGTGATAGCAAGAGATGAAAGCTCGAGCTTTCATCTCTTGCTATCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018715.2-1982s21c1
Sequence:CCGGATACTTGCTCATAGTTGATTTCTCGAGAAATCAACTATGAGCAAGTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018715.2-520s21c1
Sequence:CCGGCAACCAACTGGGACTTGATTGCTCGAGCAATCAAGTCCCAGTTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)