EMAIL THIS PAGE TO A FRIEND

RCCD1

RCC1 domain containing 1

64 Gene Product Result for
UniProtKB ID: A6NED2, B2RTP9, Q29RX6
Gene ID:
Mouse(269955) RCC1 domain containing 1
Rat(308760) RCC1 domain containing 1
Zebrafish(567613) RCC1 domain containing 1
Horse(100068990) RCC1 domain containing 1
domestic cat(101088335) RCC1 domain containing 1
dog(100683536) RCC1 domain containing 1
chicken(770213) RCC1 domain containing 1
naked mole-rat(101712749) RCC1 domain containing 1
domestic guinea pig(100728076) RCC1 domain containing 1
cow(531926) RCC1 domain containing 1
sheep(101104096) RCC1 domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173445 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173445 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173445 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_370908 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_370908 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_370908 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017919 Rosetta Predictions human pricing
NM_033544 Rosetta Predictions human pricing
XM_001066157 Rosetta Predictions rat pricing
XM_218819 Rosetta Predictions rat pricing
NM_173445 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00163006 predicted 953
2 SASI_Hs01_00163007 predicted 950
3 SASI_Hs01_00163008 predicted 1109
4 SASI_Hs01_00163009 predicted 983
5 SASI_Hs01_00163010 predicted 806
6 SASI_Hs01_00163011 predicted 980
7 SASI_Hs01_00163012 predicted 1085
8 SASI_Hs01_00163013 predicted 1122
9 SASI_Hs01_00163014 predicted 991
10 SASI_Hs01_00163015 predicted 1116
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084850 predicted 1037
2 SASI_Hs01_00084851 predicted 1033
3 SASI_Hs01_00084852 predicted 1194
4 SASI_Hs01_00084853 predicted 1064
5 SASI_Hs01_00084854 predicted 894
6 SASI_Hs01_00084855 predicted 1067
7 SASI_Hs01_00084856 predicted 1176
8 SASI_Hs01_00084857 predicted 1213
9 SASI_Hs01_00084858 predicted 1077
10 SASI_Hs01_00084859 predicted 1208
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066157 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00316444 predicted 276
2 SASI_Rn02_00316445 predicted 236
3 SASI_Rn02_00316446 predicted 289
4 SASI_Rn02_00316447 predicted 674
5 SASI_Rn02_00316448 predicted 359
6 SASI_Rn02_00316449 predicted 1004
7 SASI_Rn02_00316450 predicted 273
8 SASI_Rn02_00316451 predicted 565
9 SASI_Rn02_00316452 predicted 275
10 SASI_Rn02_00316453 predicted 278
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218819 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378082 predicted 397
2 SASI_Rn02_00378083 predicted 396
3 SASI_Rn02_00378084 predicted 352
4 SASI_Rn02_00378085 predicted 269
5 SASI_Rn02_00378086 predicted 280
6 SASI_Rn02_00378087 predicted 239
7 SASI_Rn02_00378088 predicted 456
8 SASI_Rn02_00378089 predicted 292
9 SASI_Rn02_00378090 predicted 395
10 SASI_Rn02_00378091 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173445 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00180895 predicted 1924
2 SASI_Mm01_00180896 predicted 1990
3 SASI_Mm01_00180897 predicted 1007
4 SASI_Mm01_00180898 predicted 1638
5 SASI_Mm01_00180899 predicted 911
6 SASI_Mm01_00180900 predicted 1662
7 SASI_Mm01_00180903 predicted 1978
8 SASI_Mm01_00180904 predicted 926
9 SASI_Mm02_00345351 predicted 1675
10 SASI_Mm02_00345352 predicted 1923
11 SASI_Mm01_00180901 predicted 1565
12 SASI_Mm01_00180902 predicted 994
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173445
RCCD1 MISSION shRNA Bacterial Glycerol Stock
RCC1 domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173445.1-2094s1c1
Sequence:CCGGCCTAGGTGCATGGAAACCTAACTCGAGTTAGGTTTCCATGCACCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173445.1-1006s1c1
Sequence:CCGGGCCAGTGATGATATTTGCCAACTCGAGTTGGCAAATATCATCACTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173445.1-1994s1c1
Sequence:CCGGCCTATGTCTATGCAATGGAAACTCGAGTTTCCATTGCATAGACATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173445.1-1984s1c1
Sequence:CCGGCCCTGGAATACCTATGTCTATCTCGAGATAGACATAGGTATTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173445.1-1844s1c1
Sequence:CCGGCACGCACAGGAGAACTCTATACTCGAGTATAGAGTTCTCCTGTGCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173445
RCCD1 MISSION shRNA shRNA Plasmid DNA
RCC1 domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173445.1-2094s1c1
Sequence:CCGGCCTAGGTGCATGGAAACCTAACTCGAGTTAGGTTTCCATGCACCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173445.1-1006s1c1
Sequence:CCGGGCCAGTGATGATATTTGCCAACTCGAGTTGGCAAATATCATCACTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173445.1-1994s1c1
Sequence:CCGGCCTATGTCTATGCAATGGAAACTCGAGTTTCCATTGCATAGACATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173445.1-1984s1c1
Sequence:CCGGCCCTGGAATACCTATGTCTATCTCGAGATAGACATAGGTATTCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000110169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173445.1-1844s1c1
Sequence:CCGGCACGCACAGGAGAACTCTATACTCGAGTATAGAGTTCTCCTGTGCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173445
RCCD1 MISSION shRNA Lentiviral Transduction Particles
RCC1 domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110165    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173445.1-2094s1c1
Sequence:CCGGCCTAGGTGCATGGAAACCTAACTCGAGTTAGGTTTCCATGCACCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173445.1-1006s1c1
Sequence:CCGGGCCAGTGATGATATTTGCCAACTCGAGTTGGCAAATATCATCACTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110167    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173445.1-1994s1c1
Sequence:CCGGCCTATGTCTATGCAATGGAAACTCGAGTTTCCATTGCATAGACATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173445.1-1984s1c1
Sequence:CCGGCCCTGGAATACCTATGTCTATCTCGAGATAGACATAGGTATTCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000110169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173445.1-1844s1c1
Sequence:CCGGCACGCACAGGAGAACTCTATACTCGAGTATAGAGTTCTCCTGTGCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_370908
RCCD1 MISSION shRNA Bacterial Glycerol Stock
RCC1 domain containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370908.2-778s1c1
Sequence:CCGGGAACTGAATGAAGATGGTTCTCTCGAGAGAACCATCTTCATTCAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370908.2-322s1c1
Sequence:CCGGGAGCCATTGTGGGCCCAGAATCTCGAGATTCTGGGCCCACAATGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370908.2-769s1c1
Sequence:CCGGGCAAGGGAAGAACTGAATGAACTCGAGTTCATTCAGTTCTTCCCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370908.2-600s1c1
Sequence:CCGGGCCACGGCTGTTGGAGGCGTTCTCGAGAACGCCTCCAACAGCCGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370908.2-890s1c1
Sequence:CCGGGCTCAGATGCAGTCAAGGCCACTCGAGTGGCCTTGACTGCATCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_370908
RCCD1 MISSION shRNA shRNA Plasmid DNA
RCC1 domain containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370908.2-778s1c1
Sequence:CCGGGAACTGAATGAAGATGGTTCTCTCGAGAGAACCATCTTCATTCAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370908.2-322s1c1
Sequence:CCGGGAGCCATTGTGGGCCCAGAATCTCGAGATTCTGGGCCCACAATGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370908.2-769s1c1
Sequence:CCGGGCAAGGGAAGAACTGAATGAACTCGAGTTCATTCAGTTCTTCCCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370908.2-600s1c1
Sequence:CCGGGCCACGGCTGTTGGAGGCGTTCTCGAGAACGCCTCCAACAGCCGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370908.2-890s1c1
Sequence:CCGGGCTCAGATGCAGTCAAGGCCACTCGAGTGGCCTTGACTGCATCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_370908
RCCD1 MISSION shRNA Lentiviral Transduction Particles
RCC1 domain containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045307    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370908.2-778s1c1
Sequence:CCGGGAACTGAATGAAGATGGTTCTCTCGAGAGAACCATCTTCATTCAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370908.2-322s1c1
Sequence:CCGGGAGCCATTGTGGGCCCAGAATCTCGAGATTCTGGGCCCACAATGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370908.2-769s1c1
Sequence:CCGGGCAAGGGAAGAACTGAATGAACTCGAGTTCATTCAGTTCTTCCCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370908.2-600s1c1
Sequence:CCGGGCCACGGCTGTTGGAGGCGTTCTCGAGAACGCCTCCAACAGCCGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_370908.2-890s1c1
Sequence:CCGGGCTCAGATGCAGTCAAGGCCACTCGAGTGGCCTTGACTGCATCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)