EMAIL THIS PAGE TO A FRIEND

RCE1

RCE1 homolog, prenyl protein protease (S. cerevisiae)

101 Gene Product Result for
Synonyms: FACE2 RCE1A RCE1B
UniProtKB ID: Q9Y256, Q52LZ9
Gene ID:
Human(9986) Summary: This gene encodes an integral membrane protein which is classified as a member of the metalloproteinase family. This enzyme is thought to function in the maintenance and processing of CAAX-type prenylated proteins. [provided by RefSeq, Jul 2008]
Mouse(19671) RCE1 homolog, prenyl protein peptidase (S. cerevisiae)
Rat(309153) RCE1 homolog, prenyl protein protease (S. cerevisiae)
Thale Cress(829833) RUB1 conjugating enzyme 1
dog(483705) RCE1 homolog, prenyl protein protease (S. cerevisiae)
domestic cat(101100334) RCE1 homolog, prenyl protein protease (S. cerevisiae)
Horse(100052803) RCE1 homolog, prenyl protein protease (S. cerevisiae)
cow(539539) RCE1 homolog, prenyl protein protease (S. cerevisiae)
Goat(100861127) RCE1 homolog, prenyl protein protease (S. cerevisiae)
sheep(101107239) RCE1 homolog, prenyl protein protease (S. cerevisiae)
domestic guinea pig(100719218) RCE1 homolog, prenyl protein protease (S. cerevisiae)
naked mole-rat(101713597) RCE1 homolog, prenyl protein protease (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1307170 ANTI-RCE1 (N-TERM W57) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
AV44797 Anti-RCE1 antibody produced in rabbit IgG fraction of antiserum bovine, rat, guinea pig, rabbit, canine, mouse, human, horse,
immunohistochemistry, western blot pricing
WH0009986M6 Monoclonal Anti-RCE1 antibody produced in mouse clone 6A6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005133 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005133 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005133 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023131 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023131 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023131 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU156071 MISSION® esiRNA esiRNA human RCE1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001032279 Rosetta Predictions human pricing
NM_005133 Rosetta Predictions human pricing
NM_001100585 Rosetta Predictions rat pricing
NM_023131 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001032279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099136 predicted 714
2 SASI_Hs01_00099137 predicted 628
3 SASI_Hs01_00099138 predicted 1020
4 SASI_Hs01_00099139 predicted 746
5 SASI_Hs01_00099140 predicted 565
6 SASI_Hs01_00099141 predicted 744
7 SASI_Hs01_00099142 predicted 1023
8 SASI_Hs01_00099143 predicted 726
9 SASI_Hs01_00099144 predicted 564
10 SASI_Hs01_00099145 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005133 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090347 predicted 714
2 SASI_Hs01_00090348 predicted 625
3 SASI_Hs01_00090349 predicted 1027
4 SASI_Hs01_00090350 predicted 750
5 SASI_Hs01_00090351 predicted 572
6 SASI_Hs01_00090352 predicted 749
7 SASI_Hs01_00090353 predicted 1026
8 SASI_Hs01_00090354 predicted 727
9 SASI_Hs01_00090355 predicted 566
10 SASI_Hs01_00090356 predicted 579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100585 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210128 predicted 978
2 SASI_Rn02_00210129 predicted 484
3 SASI_Rn02_00210130 predicted 508
4 SASI_Rn02_00210131 predicted 300
5 SASI_Rn02_00210132 predicted 999
6 SASI_Rn02_00210133 predicted 530
7 SASI_Rn02_00210134 predicted 430
8 SASI_Rn02_00210135 predicted 565
9 SASI_Rn02_00210136 predicted 205
10 SASI_Rn02_00210137 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326833 predicted 475
2 SASI_Mm02_00326834 predicted 486
3 SASI_Mm02_00326835 predicted 968
4 SASI_Mm02_00326836 predicted 499
5 SASI_Mm02_00326837 predicted 399
6 SASI_Mm02_00326838 predicted 385
7 SASI_Mm02_00326839 predicted 427
8 SASI_Mm02_00326840 predicted 273
9 SASI_Mm02_00326841 predicted 659
10 SASI_Mm02_00326842 predicted 423
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005133
VALIDATED
RCE1 MISSION shRNA Bacterial Glycerol Stock
RCE1 homolog, prenyl protein protease (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005133.1-830s1c1
Sequence:CCGGCTTCTGCAATTACATGGGTTTCTCGAGAAACCCATGTAATTGCAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005133.1-824s1c1
Sequence:CCGGCCATTCCTTCTGCAATTACATCTCGAGATGTAATTGCAGAAGGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005133.1-596s1c1
Sequence:CCGGGCCCATGTTAGCACCGTGCATCTCGAGATGCACGGTGCTAACATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005133.1-430s1c1
Sequence:CCGGGCCCACTGATGCAGCTCTCTACTCGAGTAGAGAGCTGCATCAGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005133.1-239s1c1
Sequence:CCGGCGCGGTCATCAAGCGACGCTTCTCGAGAAGCGTCGCTTGATGACCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005133.2-821s21c1
Sequence:CCGGCTGCCATTCCTTCTGCAATTACTCGAGTAATTGCAGAAGGAATGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005133.2-400s21c1
Sequence:CCGGCCCTGTTGCTGACCATGATTCCTCGAGGAATCATGGTCAGCAACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005133.2-678s21c1
Sequence:CCGGATTATTGAGCAGCTGCGTTTCCTCGAGGAAACGCAGCTGCTCAATAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005133.2-762s21c1
Sequence:CCGGTTCGGTGCCTACACTGCTTTCCTCGAGGAAAGCAGTGTAGGCACCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005133.2-1283s21c1
Sequence:CCGGCACACTCCCTTCCTCACTTTGCTCGAGCAAAGTGAGGAAGGGAGTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005133
VALIDATED
RCE1 MISSION shRNA shRNA Plasmid DNA
RCE1 homolog, prenyl protein protease (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005133.1-830s1c1
Sequence:CCGGCTTCTGCAATTACATGGGTTTCTCGAGAAACCCATGTAATTGCAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005133.1-824s1c1
Sequence:CCGGCCATTCCTTCTGCAATTACATCTCGAGATGTAATTGCAGAAGGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005133.1-596s1c1
Sequence:CCGGGCCCATGTTAGCACCGTGCATCTCGAGATGCACGGTGCTAACATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005133.1-430s1c1
Sequence:CCGGGCCCACTGATGCAGCTCTCTACTCGAGTAGAGAGCTGCATCAGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005133.1-239s1c1
Sequence:CCGGCGCGGTCATCAAGCGACGCTTCTCGAGAAGCGTCGCTTGATGACCGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005133.2-821s21c1
Sequence:CCGGCTGCCATTCCTTCTGCAATTACTCGAGTAATTGCAGAAGGAATGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005133.2-400s21c1
Sequence:CCGGCCCTGTTGCTGACCATGATTCCTCGAGGAATCATGGTCAGCAACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005133.2-678s21c1
Sequence:CCGGATTATTGAGCAGCTGCGTTTCCTCGAGGAAACGCAGCTGCTCAATAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000271614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005133.2-762s21c1
Sequence:CCGGTTCGGTGCCTACACTGCTTTCCTCGAGGAAAGCAGTGTAGGCACCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005133.2-1283s21c1
Sequence:CCGGCACACTCCCTTCCTCACTTTGCTCGAGCAAAGTGAGGAAGGGAGTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005133
VALIDATED
RCE1 MISSION shRNA Lentiviral Transduction Particles
RCE1 homolog, prenyl protein protease (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005133.1-830s1c1
Sequence:CCGGCTTCTGCAATTACATGGGTTTCTCGAGAAACCCATGTAATTGCAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005133.1-824s1c1
Sequence:CCGGCCATTCCTTCTGCAATTACATCTCGAGATGTAATTGCAGAAGGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005133.1-596s1c1
Sequence:CCGGGCCCATGTTAGCACCGTGCATCTCGAGATGCACGGTGCTAACATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005133.1-430s1c1
Sequence:CCGGGCCCACTGATGCAGCTCTCTACTCGAGTAGAGAGCTGCATCAGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005133.1-239s1c1
Sequence:CCGGCGCGGTCATCAAGCGACGCTTCTCGAGAAGCGTCGCTTGATGACCGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350648    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005133.2-821s21c1
Sequence:CCGGCTGCCATTCCTTCTGCAATTACTCGAGTAATTGCAGAAGGAATGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005133.2-400s21c1
Sequence:CCGGCCCTGTTGCTGACCATGATTCCTCGAGGAATCATGGTCAGCAACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005133.2-678s21c1
Sequence:CCGGATTATTGAGCAGCTGCGTTTCCTCGAGGAAACGCAGCTGCTCAATAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000271614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005133.2-762s21c1
Sequence:CCGGTTCGGTGCCTACACTGCTTTCCTCGAGGAAAGCAGTGTAGGCACCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284478    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005133.2-1283s21c1
Sequence:CCGGCACACTCCCTTCCTCACTTTGCTCGAGCAAAGTGAGGAAGGGAGTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023131
VALIDATED
RCE1 MISSION shRNA Bacterial Glycerol Stock
RCE1 homolog, prenyl protein protease (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023131.1-780s1c1
Sequence:CCGGCCACTCTTTCTGCAACTACATCTCGAGATGTAGTTGCAGAAAGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023131.1-488s1c1
Sequence:CCGGGCTGGCTACGAAACCAAGTTACTCGAGTAACTTGGTTTCGTAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023131.1-913s1c1
Sequence:CCGGCCCAAGCTCTATGGCAGCCTTCTCGAGAAGGCTGCCATAGAGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023131.1-194s1c1
Sequence:CCGGCCGCTGTTATCAAGCGGCGTTCTCGAGAACGCCGCTTGATAACAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023131.1-359s1c1
Sequence:CCGGTGCTGCTAACTATGATCCTTTCTCGAGAAAGGATCATAGTTAGCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023131.1-488s21c1
Sequence:CCGGGCTGGCTACGAAACCAAGTTACTCGAGTAACTTGGTTTCGTAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023131.1-359s21c1
Sequence:CCGGTGCTGCTAACTATGATCCTTTCTCGAGAAAGGATCATAGTTAGCAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023131.1-913s21c1
Sequence:CCGGCCCAAGCTCTATGGCAGCCTTCTCGAGAAGGCTGCCATAGAGCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023131.1-780s21c1
Sequence:CCGGCCACTCTTTCTGCAACTACATCTCGAGATGTAGTTGCAGAAAGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023131
VALIDATED
RCE1 MISSION shRNA shRNA Plasmid DNA
RCE1 homolog, prenyl protein protease (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023131.1-780s1c1
Sequence:CCGGCCACTCTTTCTGCAACTACATCTCGAGATGTAGTTGCAGAAAGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023131.1-488s1c1
Sequence:CCGGGCTGGCTACGAAACCAAGTTACTCGAGTAACTTGGTTTCGTAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023131.1-913s1c1
Sequence:CCGGCCCAAGCTCTATGGCAGCCTTCTCGAGAAGGCTGCCATAGAGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023131.1-194s1c1
Sequence:CCGGCCGCTGTTATCAAGCGGCGTTCTCGAGAACGCCGCTTGATAACAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023131.1-359s1c1
Sequence:CCGGTGCTGCTAACTATGATCCTTTCTCGAGAAAGGATCATAGTTAGCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023131.1-488s21c1
Sequence:CCGGGCTGGCTACGAAACCAAGTTACTCGAGTAACTTGGTTTCGTAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023131.1-359s21c1
Sequence:CCGGTGCTGCTAACTATGATCCTTTCTCGAGAAAGGATCATAGTTAGCAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023131.1-913s21c1
Sequence:CCGGCCCAAGCTCTATGGCAGCCTTCTCGAGAAGGCTGCCATAGAGCTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000354157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023131.1-780s21c1
Sequence:CCGGCCACTCTTTCTGCAACTACATCTCGAGATGTAGTTGCAGAAAGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023131
VALIDATED
RCE1 MISSION shRNA Lentiviral Transduction Particles
RCE1 homolog, prenyl protein protease (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023131.1-780s1c1
Sequence:CCGGCCACTCTTTCTGCAACTACATCTCGAGATGTAGTTGCAGAAAGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023131.1-488s1c1
Sequence:CCGGGCTGGCTACGAAACCAAGTTACTCGAGTAACTTGGTTTCGTAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031472    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023131.1-913s1c1
Sequence:CCGGCCCAAGCTCTATGGCAGCCTTCTCGAGAAGGCTGCCATAGAGCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023131.1-194s1c1
Sequence:CCGGCCGCTGTTATCAAGCGGCGTTCTCGAGAACGCCGCTTGATAACAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023131.1-359s1c1
Sequence:CCGGTGCTGCTAACTATGATCCTTTCTCGAGAAAGGATCATAGTTAGCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023131.1-488s21c1
Sequence:CCGGGCTGGCTACGAAACCAAGTTACTCGAGTAACTTGGTTTCGTAGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023131.1-359s21c1
Sequence:CCGGTGCTGCTAACTATGATCCTTTCTCGAGAAAGGATCATAGTTAGCAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023131.1-913s21c1
Sequence:CCGGCCCAAGCTCTATGGCAGCCTTCTCGAGAAGGCTGCCATAGAGCTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000354157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023131.1-780s21c1
Sequence:CCGGCCACTCTTTCTGCAACTACATCTCGAGATGTAGTTGCAGAAAGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)