EMAIL THIS PAGE TO A FRIEND

RCHY1

ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase

159 Gene Product Result for
Synonyms: ARNIP CHIMP PIRH2 PRO1996 RNF199 ZNF363
Gene ID:
Human(25898) Summary: The protein encoded by this gene has ubiquitin ligase activity. It mediates E3-dependent ubiquitination and proteasomal degradation of target proteins, including tumor protein 53, histone deacetylase 1, and cyclin-dependent kinase inhibitor 1B, thus regulating their levels and cell cycle progression. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jun 2013]
Mouse(68098) ring finger and CHY zinc finger domain containing 1
Rat(289508) ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase
Zebrafish(321875) ring finger and CHY zinc finger domain containing 1
chicken(771726) ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase
dog(612746) ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase
domestic cat(101080785) ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase
naked mole-rat(101700191) ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase
domestic guinea pig(100733287) ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase
cow(540733) ring finger and CHY zinc finger domain containing 1
sheep(100302546) ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015436 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015436 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015436 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026557 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026557 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026557 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008925 Rosetta Predictions human pricing
NM_001009922 Rosetta Predictions human pricing
NM_015436 Rosetta Predictions human pricing
NM_001007618 Rosetta Predictions rat pricing
NM_026557 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008925 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205241 predicted 389
2 SASI_Hs01_00205242 predicted 265
3 SASI_Hs01_00205244 predicted 1168
4 SASI_Hs01_00205245 predicted 1174
5 SASI_Hs02_00305597 predicted 348
6 SASI_Hs01_00205246 predicted 971
7 SASI_Hs01_00205247 predicted 1082
8 SASI_Hs01_00205248 predicted 1076
9 SASI_Hs01_00205249 predicted 285
10 SASI_Hs01_00205250 predicted 1019
11 SASI_Hs01_00205243 predicted 1198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009922 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167586 predicted 384
2 SASI_Hs01_00167587 predicted 265
3 SASI_Hs01_00167589 predicted 1141
4 SASI_Hs01_00167590 predicted 1154
5 SASI_Hs02_00305719 predicted 340
6 SASI_Hs01_00167591 predicted 954
7 SASI_Hs01_00167592 predicted 1062
8 SASI_Hs01_00167593 predicted 1052
9 SASI_Hs01_00167594 predicted 277
10 SASI_Hs01_00167595 predicted 997
11 SASI_Hs01_00167588 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042332 predicted 388
2 SASI_Hs01_00042333 predicted 267
3 SASI_Hs01_00042335 predicted 1174
4 SASI_Hs01_00042336 predicted 1184
5 SASI_Hs02_00347824 predicted 341
6 SASI_Hs01_00042337 predicted 982
7 SASI_Hs01_00042338 predicted 1089
8 SASI_Hs01_00042339 predicted 1071
9 SASI_Hs01_00042340 predicted 284
10 SASI_Hs01_00042341 predicted 1019
11 SASI_Hs01_00042334 predicted 1203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108447 predicted 1106
2 SASI_Rn01_00108448 predicted 1247
3 SASI_Rn01_00108449 predicted 1275
4 SASI_Rn01_00108451 predicted 1110
5 SASI_Rn01_00108452 predicted 1056
6 SASI_Rn01_00108454 predicted 1093
7 SASI_Rn01_00108455 predicted 943
8 SASI_Rn02_00198707 predicted 1048
9 SASI_Rn02_00198708 predicted 928
10 SASI_Rn02_00198709 predicted 947
11 SASI_Rn01_00108446 predicted 626
12 SASI_Rn01_00108450 predicted 988
13 SASI_Rn01_00108453 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026557 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330488 predicted 604
2 SASI_Mm02_00330489 predicted 1195
3 SASI_Mm02_00330490 predicted 998
4 SASI_Mm02_00330491 predicted 604
5 SASI_Mm02_00330492 predicted 700
6 SASI_Mm02_00330493 predicted 1071
7 SASI_Mm02_00330494 predicted 587
8 SASI_Mm02_00330495 predicted 909
9 SASI_Mm02_00330496 predicted 1016
10 SASI_Mm02_00330497 predicted 1057
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015436
VALIDATED
RCHY1 MISSION shRNA Bacterial Glycerol Stock
ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015436.2-669s21c1
Sequence:CCGGAGGCTACAGATGTCCATTATGCTCGAGCATAATGGACATCTGTAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015436.2-987s21c1
Sequence:CCGGTATCATGTGTCGTCATCTATGCTCGAGCATAGATGACGACACATGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015436.2-379s21c1
Sequence:CCGGGGAGAATATTATTGCGATATACTCGAGTATATCGCAATAATATTCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015436.2-855s21c1
Sequence:CCGGGATTTGTGAATCCTATAATACCTCGAGGTATTATAGGATTCACAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015436.x-194s1c1
Sequence:CCGGAGTGAAGGAAGTGCAGTGCATCTCGAGATGCACTGCACTTCCTTCACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015436.x-1382s1c1
Sequence:CCGGGCTCAATTAGGGCAGTATCATCTCGAGATGATACTGCCCTAATTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015436.x-490s1c1
Sequence:CCGGCCCGTGTTGTTGCTCATGTCTCTCGAGAGACATGAGCAACAACACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015436.x-691s1c1
Sequence:CCGGGCAATGACTGTAATGGACGATCTCGAGATCGTCCATTACAGTCATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015436.x-593s1c1
Sequence:CCGGTGCTTTAGATATGACCAGGTACTCGAGTACCTGGTCATATCTAAAGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015436
VALIDATED
RCHY1 MISSION shRNA shRNA Plasmid DNA
ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015436.2-669s21c1
Sequence:CCGGAGGCTACAGATGTCCATTATGCTCGAGCATAATGGACATCTGTAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015436.2-987s21c1
Sequence:CCGGTATCATGTGTCGTCATCTATGCTCGAGCATAGATGACGACACATGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015436.2-379s21c1
Sequence:CCGGGGAGAATATTATTGCGATATACTCGAGTATATCGCAATAATATTCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015436.2-855s21c1
Sequence:CCGGGATTTGTGAATCCTATAATACCTCGAGGTATTATAGGATTCACAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015436.x-194s1c1
Sequence:CCGGAGTGAAGGAAGTGCAGTGCATCTCGAGATGCACTGCACTTCCTTCACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015436.x-1382s1c1
Sequence:CCGGGCTCAATTAGGGCAGTATCATCTCGAGATGATACTGCCCTAATTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015436.x-490s1c1
Sequence:CCGGCCCGTGTTGTTGCTCATGTCTCTCGAGAGACATGAGCAACAACACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015436.x-691s1c1
Sequence:CCGGGCAATGACTGTAATGGACGATCTCGAGATCGTCCATTACAGTCATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015436.x-593s1c1
Sequence:CCGGTGCTTTAGATATGACCAGGTACTCGAGTACCTGGTCATATCTAAAGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015436
VALIDATED
RCHY1 MISSION shRNA Lentiviral Transduction Particles
ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015436.2-669s21c1
Sequence:CCGGAGGCTACAGATGTCCATTATGCTCGAGCATAATGGACATCTGTAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015436.2-987s21c1
Sequence:CCGGTATCATGTGTCGTCATCTATGCTCGAGCATAGATGACGACACATGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293609    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015436.2-379s21c1
Sequence:CCGGGGAGAATATTATTGCGATATACTCGAGTATATCGCAATAATATTCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015436.2-855s21c1
Sequence:CCGGGATTTGTGAATCCTATAATACCTCGAGGTATTATAGGATTCACAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015436.x-194s1c1
Sequence:CCGGAGTGAAGGAAGTGCAGTGCATCTCGAGATGCACTGCACTTCCTTCACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004089    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015436.x-1382s1c1
Sequence:CCGGGCTCAATTAGGGCAGTATCATCTCGAGATGATACTGCCCTAATTGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015436.x-490s1c1
Sequence:CCGGCCCGTGTTGTTGCTCATGTCTCTCGAGAGACATGAGCAACAACACGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_015436.x-691s1c1
Sequence:CCGGGCAATGACTGTAATGGACGATCTCGAGATCGTCCATTACAGTCATTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015436.x-593s1c1
Sequence:CCGGTGCTTTAGATATGACCAGGTACTCGAGTACCTGGTCATATCTAAAGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026557
VALIDATED
RCHY1 MISSION shRNA Bacterial Glycerol Stock
ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026557.2-983s1c1
Sequence:CCGGGAATACCAGAACGTGACTGTTCTCGAGAACAGTCACGTTCTGGTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026557.3-597s1c1
Sequence:CCGGGAGAATATTACTGCAGTATTTCTCGAGAAATACTGCAGTAATATTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026557.3-1310s1c1
Sequence:CCGGGGTGATTGTAATAGCGATTACCTCGAGGTAATCGCTATTACAATCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026557.3-772s21c1
Sequence:CCGGCCGGCAGAATTGTCCAATATGCTCGAGCATATTGGACAATTCTGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026557.3-1411s21c1
Sequence:CCGGTAGTCACATTCATCGAAATATCTCGAGATATTTCGATGAATGTGACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026557.3-968s21c1
Sequence:CCGGACTCCCATGCCATCCGAATACCTCGAGGTATTCGGATGGCATGGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026557.3-848s21c1
Sequence:CCGGCTCCTACATAGAACGTGTTATCTCGAGATAACACGTTCTATGTAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026557
VALIDATED
RCHY1 MISSION shRNA shRNA Plasmid DNA
ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026557.2-983s1c1
Sequence:CCGGGAATACCAGAACGTGACTGTTCTCGAGAACAGTCACGTTCTGGTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026557.3-597s1c1
Sequence:CCGGGAGAATATTACTGCAGTATTTCTCGAGAAATACTGCAGTAATATTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026557.3-1310s1c1
Sequence:CCGGGGTGATTGTAATAGCGATTACCTCGAGGTAATCGCTATTACAATCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026557.3-772s21c1
Sequence:CCGGCCGGCAGAATTGTCCAATATGCTCGAGCATATTGGACAATTCTGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026557.3-1411s21c1
Sequence:CCGGTAGTCACATTCATCGAAATATCTCGAGATATTTCGATGAATGTGACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026557.3-968s21c1
Sequence:CCGGACTCCCATGCCATCCGAATACCTCGAGGTATTCGGATGGCATGGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026557.3-848s21c1
Sequence:CCGGCTCCTACATAGAACGTGTTATCTCGAGATAACACGTTCTATGTAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026557
VALIDATED
RCHY1 MISSION shRNA Lentiviral Transduction Particles
ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026557.2-983s1c1
Sequence:CCGGGAATACCAGAACGTGACTGTTCTCGAGAACAGTCACGTTCTGGTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026557.3-597s1c1
Sequence:CCGGGAGAATATTACTGCAGTATTTCTCGAGAAATACTGCAGTAATATTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217325    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026557.3-1310s1c1
Sequence:CCGGGGTGATTGTAATAGCGATTACCTCGAGGTAATCGCTATTACAATCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026557.3-772s21c1
Sequence:CCGGCCGGCAGAATTGTCCAATATGCTCGAGCATATTGGACAATTCTGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241092    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026557.3-1411s21c1
Sequence:CCGGTAGTCACATTCATCGAAATATCTCGAGATATTTCGATGAATGTGACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241091    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026557.3-968s21c1
Sequence:CCGGACTCCCATGCCATCCGAATACCTCGAGGTATTCGGATGGCATGGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026557.3-848s21c1
Sequence:CCGGCTCCTACATAGAACGTGTTATCTCGAGATAACACGTTCTATGTAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)