EMAIL THIS PAGE TO A FRIEND

RCL1

RNA terminal phosphate cyclase-like 1

57 Gene Product Result for
Synonyms: RNAC RPCL1
UniProtKB ID: Q9Y2P8, D3DRI2, Q5VYW9, Q9H9D0, Q9NY00, Q9P044
Gene ID:
Mouse(59028) RNA terminal phosphate cyclase-like 1
Rat(309301) RNA terminal phosphate cyclase-like 1
Zebrafish(445388) RNA terminal phosphate cyclase-like 1
chicken(427222) RNA terminal phosphate cyclase-like 1
domestic cat(101089219) RNA terminal phosphate cyclase-like 1
Horse(100059280) RNA terminal phosphate cyclase-like 1
dog(484183) RNA terminal phosphate cyclase-like 1
cow(768075) RNA terminal phosphate cyclase-like 1
sheep(101113654) RNA terminal phosphate cyclase-like 1
domestic guinea pig(100720155) RNA terminal phosphate cyclase-like 1
naked mole-rat(101716894) RNA terminal phosphate cyclase-like 1
Domestic Rabbit(100347543) RNA terminal phosphate cyclase-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021525 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021525 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021525 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005772 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005772 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005772 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005772 Rosetta Predictions human pricing
NM_001013152 Rosetta Predictions rat pricing
NM_021525 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005772 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042142 predicted 915
2 SASI_Hs01_00042143 predicted 559
3 SASI_Hs01_00042146 predicted 1371
4 SASI_Hs02_00340248 predicted 1376
5 SASI_Hs01_00042148 predicted 1464
6 SASI_Hs01_00042149 predicted 637
7 SASI_Hs01_00042150 predicted 693
8 SASI_Hs02_00340249 predicted 1145
9 SASI_Hs02_00340250 predicted 556
10 SASI_Hs02_00340251 predicted 860
11 SASI_Hs01_00042144 predicted 351
12 SASI_Hs01_00042145 predicted 338
13 SASI_Hs01_00042147 predicted 589
14 SASI_Hs01_00042151 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013152 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094827 predicted 313
2 SASI_Rn01_00094828 predicted 348
3 SASI_Rn01_00094829 predicted 855
4 SASI_Rn01_00094830 predicted 497
5 SASI_Rn01_00094831 predicted 284
6 SASI_Rn01_00094833 predicted 773
7 SASI_Rn01_00094834 predicted 320
8 SASI_Rn01_00094835 predicted 735
9 SASI_Rn01_00094836 predicted 556
10 SASI_Rn02_00200880 predicted 357
11 SASI_Rn01_00094832 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021525 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159895 predicted 278
2 SASI_Mm01_00159896 predicted 564
3 SASI_Mm01_00159897 predicted 323
4 SASI_Mm01_00159898 predicted 439
5 SASI_Mm01_00159899 predicted 807
6 SASI_Mm01_00159900 predicted 956
7 SASI_Mm01_00159901 predicted 308
8 SASI_Mm01_00159902 predicted 1194
9 SASI_Mm01_00159903 predicted 553
10 SASI_Mm02_00326257 predicted 1240
11 SASI_Mm01_00159904 predicted 1215
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021525
VALIDATED
RCL1 MISSION shRNA Bacterial Glycerol Stock
RNA terminal phosphate cyclase-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021525.2-1350s1c1
Sequence:CCGGCCTCTTAACATTACAGACTTTCTCGAGAAAGTCTGTAATGTTAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021525.2-331s1c1
Sequence:CCGGCCAAACAGGAACAACCTTATACTCGAGTATAAGGTTGTTCCTGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021525.2-215s1c1
Sequence:CCGGCCGGTCAAGATCCGCAGGATTCTCGAGAATCCTGCGGATCTTGACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021525.2-1198s1c1
Sequence:CCGGGCTAATGACCTGCGTTGGTATCTCGAGATACCAACGCAGGTCATTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021525.2-449s1c1
Sequence:CCGGCCGTTTATGAAACACCCATTACTCGAGTAATGGGTGTTTCATAAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021525.2-712s21c1
Sequence:CCGGGGCGTACTCAGTTCGTGTATCCTCGAGGATACACGAACTGAGTACGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021525.2-437s21c1
Sequence:CCGGCTTTGCCTGGCTCCGTTTATGCTCGAGCATAAACGGAGCCAGGCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021525.2-403s21c1
Sequence:CCGGCCTCCGTGGCATTGGCTATTACTCGAGTAATAGCCAATGCCACGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021525.2-1556s21c1
Sequence:CCGGTGTGGCTCTGTGTAGGGTTTACTCGAGTAAACCCTACACAGAGCCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021525.2-1198s21c1
Sequence:CCGGGCTAATGACCTGCGTTGGTATCTCGAGATACCAACGCAGGTCATTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021525
VALIDATED
RCL1 MISSION shRNA shRNA Plasmid DNA
RNA terminal phosphate cyclase-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021525.2-1350s1c1
Sequence:CCGGCCTCTTAACATTACAGACTTTCTCGAGAAAGTCTGTAATGTTAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021525.2-331s1c1
Sequence:CCGGCCAAACAGGAACAACCTTATACTCGAGTATAAGGTTGTTCCTGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021525.2-215s1c1
Sequence:CCGGCCGGTCAAGATCCGCAGGATTCTCGAGAATCCTGCGGATCTTGACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021525.2-1198s1c1
Sequence:CCGGGCTAATGACCTGCGTTGGTATCTCGAGATACCAACGCAGGTCATTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021525.2-449s1c1
Sequence:CCGGCCGTTTATGAAACACCCATTACTCGAGTAATGGGTGTTTCATAAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021525.2-712s21c1
Sequence:CCGGGGCGTACTCAGTTCGTGTATCCTCGAGGATACACGAACTGAGTACGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021525.2-437s21c1
Sequence:CCGGCTTTGCCTGGCTCCGTTTATGCTCGAGCATAAACGGAGCCAGGCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021525.2-403s21c1
Sequence:CCGGCCTCCGTGGCATTGGCTATTACTCGAGTAATAGCCAATGCCACGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021525.2-1556s21c1
Sequence:CCGGTGTGGCTCTGTGTAGGGTTTACTCGAGTAAACCCTACACAGAGCCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021525.2-1198s21c1
Sequence:CCGGGCTAATGACCTGCGTTGGTATCTCGAGATACCAACGCAGGTCATTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021525
VALIDATED
RCL1 MISSION shRNA Lentiviral Transduction Particles
RNA terminal phosphate cyclase-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102445    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021525.2-1350s1c1
Sequence:CCGGCCTCTTAACATTACAGACTTTCTCGAGAAAGTCTGTAATGTTAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102447    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021525.2-331s1c1
Sequence:CCGGCCAAACAGGAACAACCTTATACTCGAGTATAAGGTTGTTCCTGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021525.2-215s1c1
Sequence:CCGGCCGGTCAAGATCCGCAGGATTCTCGAGAATCCTGCGGATCTTGACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_021525.2-1198s1c1
Sequence:CCGGGCTAATGACCTGCGTTGGTATCTCGAGATACCAACGCAGGTCATTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021525.2-449s1c1
Sequence:CCGGCCGTTTATGAAACACCCATTACTCGAGTAATGGGTGTTTCATAAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021525.2-712s21c1
Sequence:CCGGGGCGTACTCAGTTCGTGTATCCTCGAGGATACACGAACTGAGTACGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021525.2-437s21c1
Sequence:CCGGCTTTGCCTGGCTCCGTTTATGCTCGAGCATAAACGGAGCCAGGCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021525.2-403s21c1
Sequence:CCGGCCTCCGTGGCATTGGCTATTACTCGAGTAATAGCCAATGCCACGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313690    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_021525.2-1556s21c1
Sequence:CCGGTGTGGCTCTGTGTAGGGTTTACTCGAGTAAACCCTACACAGAGCCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021525.2-1198s21c1
Sequence:CCGGGCTAATGACCTGCGTTGGTATCTCGAGATACCAACGCAGGTCATTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005772
RCL1 MISSION shRNA Bacterial Glycerol Stock
RNA terminal phosphate cyclase-like 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005772.2-1844s1c1
Sequence:CCGGCGGATCTTCATCTGGTTCATTCTCGAGAATGAACCAGATGAAGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005772.2-1240s1c1
Sequence:CCGGGCATTGGTTTCTCCAACCTTACTCGAGTAAGGTTGGAGAAACCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005772.2-474s1c1
Sequence:CCGGCCATTTATGAAGCACCCGTTACTCGAGTAACGGGTGCTTCATAAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005772.2-331s1c1
Sequence:CCGGCGAATGGTTCTCGAATTGAAACTCGAGTTTCAATTCGAGAACCATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000451297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005772.3-1440s21c1
Sequence:CCGGCAATGGGACCAAGTCCAAATGCTCGAGCATTTGGACTTGGTCCCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005772.3-688s21c1
Sequence:CCGGGGGATTGATGGTGAATCATTTCTCGAGAAATGATTCACCATCAATCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005772.3-1476s21c1
Sequence:CCGGGAATAGCCACTTGCTTAATTTCTCGAGAAATTAAGCAAGTGGCTATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005772.2-1115s1c2
Sequence:CCGGCTCTCCCTACACGATAGAATTCTCGAGAATTCTATCGTGTAGGGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005772
RCL1 MISSION shRNA shRNA Plasmid DNA
RNA terminal phosphate cyclase-like 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005772.2-1844s1c1
Sequence:CCGGCGGATCTTCATCTGGTTCATTCTCGAGAATGAACCAGATGAAGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005772.2-1240s1c1
Sequence:CCGGGCATTGGTTTCTCCAACCTTACTCGAGTAAGGTTGGAGAAACCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005772.2-474s1c1
Sequence:CCGGCCATTTATGAAGCACCCGTTACTCGAGTAACGGGTGCTTCATAAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000078379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005772.2-331s1c1
Sequence:CCGGCGAATGGTTCTCGAATTGAAACTCGAGTTTCAATTCGAGAACCATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000451297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005772.3-1440s21c1
Sequence:CCGGCAATGGGACCAAGTCCAAATGCTCGAGCATTTGGACTTGGTCCCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005772.3-688s21c1
Sequence:CCGGGGGATTGATGGTGAATCATTTCTCGAGAAATGATTCACCATCAATCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005772.3-1476s21c1
Sequence:CCGGGAATAGCCACTTGCTTAATTTCTCGAGAAATTAAGCAAGTGGCTATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000222716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005772.2-1115s1c2
Sequence:CCGGCTCTCCCTACACGATAGAATTCTCGAGAATTCTATCGTGTAGGGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005772
RCL1 MISSION shRNA Lentiviral Transduction Particles
RNA terminal phosphate cyclase-like 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078378    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005772.2-1844s1c1
Sequence:CCGGCGGATCTTCATCTGGTTCATTCTCGAGAATGAACCAGATGAAGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005772.2-1240s1c1
Sequence:CCGGGCATTGGTTTCTCCAACCTTACTCGAGTAAGGTTGGAGAAACCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005772.2-474s1c1
Sequence:CCGGCCATTTATGAAGCACCCGTTACTCGAGTAACGGGTGCTTCATAAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000078379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005772.2-331s1c1
Sequence:CCGGCGAATGGTTCTCGAATTGAAACTCGAGTTTCAATTCGAGAACCATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000451297    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005772.3-1440s21c1
Sequence:CCGGCAATGGGACCAAGTCCAAATGCTCGAGCATTTGGACTTGGTCCCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005772.3-688s21c1
Sequence:CCGGGGGATTGATGGTGAATCATTTCTCGAGAAATGATTCACCATCAATCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445551    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005772.3-1476s21c1
Sequence:CCGGGAATAGCCACTTGCTTAATTTCTCGAGAAATTAAGCAAGTGGCTATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000222716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005772.2-1115s1c2
Sequence:CCGGCTCTCCCTACACGATAGAATTCTCGAGAATTCTATCGTGTAGGGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)