EMAIL THIS PAGE TO A FRIEND

RCN2

reticulocalbin 2, EF-hand calcium binding domain

54 Gene Product Result for
Synonyms: E6BP ERC-55 ERC55 TCBP49
UniProtKB ID: Q14257, A8MTG6, Q53XN8
Gene ID:
Human(5955) Summary: The protein encoded by this gene is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. This gene maps to the same region as type 4 Bardet-Biedl syndrome, suggesting a possible causative role for this gene in the disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
Mouse(26611) reticulocalbin 2
Rat(29218) reticulocalbin 2, EF-hand calcium binding domain
Zebrafish(571340) reticulocalbin 2
domestic cat(101099968) reticulocalbin 2, EF-hand calcium binding domain
dog(487666) reticulocalbin 2, EF-hand calcium binding domain
chicken(415350) reticulocalbin 2, EF-hand calcium binding domain
cow(512717) reticulocalbin 2, EF-hand calcium binding domain
sheep(101116682) reticulocalbin 2, EF-hand calcium binding domain
domestic guinea pig(100722955) reticulocalbin 2, EF-hand calcium binding domain
naked mole-rat(101724331) reticulocalbin 2, EF-hand calcium binding domain
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011992 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011992 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011992 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002902 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002902 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002902 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002902 Rosetta Predictions human pricing
NM_017132 Rosetta Predictions rat pricing
NM_011992 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002902 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011609 predicted 738
2 SASI_Hs01_00011610 predicted 623
3 SASI_Hs02_00334711 predicted 451
4 SASI_Hs01_00011612 predicted 910
5 SASI_Hs01_00011613 predicted 815
6 SASI_Hs02_00334712 predicted 603
7 SASI_Hs01_00011615 predicted 628
8 SASI_Hs02_00334713 predicted 408
9 SASI_Hs01_00011616 predicted 435
10 SASI_Hs01_00011617 predicted 1031
11 SASI_Hs01_00011608 predicted 688
12 SASI_Hs01_00011611 predicted 1110
13 SASI_Hs01_00011614 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017132 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053337 predicted 496
2 SASI_Rn01_00053338 predicted 1276
3 SASI_Rn01_00053339 predicted 905
4 SASI_Rn02_00261372 predicted 896
5 SASI_Rn01_00053340 predicted 605
6 SASI_Rn01_00053341 predicted 1252
7 SASI_Rn01_00053342 predicted 660
8 SASI_Rn02_00261373 predicted 1267
9 SASI_Rn01_00053343 predicted 1129
10 SASI_Rn01_00053345 predicted 715
11 SASI_Rn01_00053344 predicted 500
12 SASI_Rn01_00053346 predicted 932
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011992 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065650 predicted 1254
2 SASI_Mm02_00321918 predicted 1248
3 SASI_Mm01_00065648 predicted 520
4 SASI_Mm01_00065649 predicted 884
5 SASI_Mm01_00065651 predicted 833
6 SASI_Mm01_00065652 predicted 882
7 SASI_Mm01_00065653 predicted 582
8 SASI_Mm01_00065654 predicted 788
9 SASI_Mm01_00065655 predicted 778
10 SASI_Mm01_00065657 predicted 1111
11 SASI_Mm01_00065656 predicted 395
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011992
VALIDATED
RCN2 MISSION shRNA Bacterial Glycerol Stock
reticulocalbin 2, EF-hand calcium binding domain
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011992.1-785s1c1
Sequence:CCGGGCTTTGGAAGAACATGACAAACTCGAGTTTGTCATGTTCTTCCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011992.1-739s1c1
Sequence:CCGGGCACCCTGAAGAAGTTGACTACTCGAGTAGTCAACTTCTTCAGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011992.1-1407s1c1
Sequence:CCGGCCATCTATGTAGTGCTGTGTTCTCGAGAACACAGCACTACATAGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011992.1-353s1c1
Sequence:CCGGGTCGATGAGTATGTTAAACTTCTCGAGAAGTTTAACATACTCATCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011992.2-663s21c1
Sequence:CCGGGCTTCATCTAAAGGATAAGAACTCGAGTTCTTATCCTTTAGATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011992.1-652s1c1
Sequence:CCGGGCTTCATCTAAAGGATAAGAACTCGAGTTCTTATCCTTTAGATGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011992.2-367s21c1
Sequence:CCGGGTCGATGAGTATGTTAAACTTCTCGAGAAGTTTAACATACTCATCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011992.2-796s21c1
Sequence:CCGGGCTTTGGAAGAACATGACAAACTCGAGTTTGTCATGTTCTTCCAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011992
VALIDATED
RCN2 MISSION shRNA shRNA Plasmid DNA
reticulocalbin 2, EF-hand calcium binding domain
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011992.1-785s1c1
Sequence:CCGGGCTTTGGAAGAACATGACAAACTCGAGTTTGTCATGTTCTTCCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011992.1-739s1c1
Sequence:CCGGGCACCCTGAAGAAGTTGACTACTCGAGTAGTCAACTTCTTCAGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011992.1-1407s1c1
Sequence:CCGGCCATCTATGTAGTGCTGTGTTCTCGAGAACACAGCACTACATAGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011992.1-353s1c1
Sequence:CCGGGTCGATGAGTATGTTAAACTTCTCGAGAAGTTTAACATACTCATCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011992.2-663s21c1
Sequence:CCGGGCTTCATCTAAAGGATAAGAACTCGAGTTCTTATCCTTTAGATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011992.1-652s1c1
Sequence:CCGGGCTTCATCTAAAGGATAAGAACTCGAGTTCTTATCCTTTAGATGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011992.2-367s21c1
Sequence:CCGGGTCGATGAGTATGTTAAACTTCTCGAGAAGTTTAACATACTCATCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011992.2-796s21c1
Sequence:CCGGGCTTTGGAAGAACATGACAAACTCGAGTTTGTCATGTTCTTCCAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011992
VALIDATED
RCN2 MISSION shRNA Lentiviral Transduction Particles
reticulocalbin 2, EF-hand calcium binding domain
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011992.1-785s1c1
Sequence:CCGGGCTTTGGAAGAACATGACAAACTCGAGTTTGTCATGTTCTTCCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011992.1-739s1c1
Sequence:CCGGGCACCCTGAAGAAGTTGACTACTCGAGTAGTCAACTTCTTCAGGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011992.1-1407s1c1
Sequence:CCGGCCATCTATGTAGTGCTGTGTTCTCGAGAACACAGCACTACATAGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011992.1-353s1c1
Sequence:CCGGGTCGATGAGTATGTTAAACTTCTCGAGAAGTTTAACATACTCATCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011992.2-663s21c1
Sequence:CCGGGCTTCATCTAAAGGATAAGAACTCGAGTTCTTATCCTTTAGATGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011992.1-652s1c1
Sequence:CCGGGCTTCATCTAAAGGATAAGAACTCGAGTTCTTATCCTTTAGATGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011992.2-367s21c1
Sequence:CCGGGTCGATGAGTATGTTAAACTTCTCGAGAAGTTTAACATACTCATCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011992.2-796s21c1
Sequence:CCGGGCTTTGGAAGAACATGACAAACTCGAGTTTGTCATGTTCTTCCAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002902
VALIDATED
RCN2 MISSION shRNA Bacterial Glycerol Stock
reticulocalbin 2, EF-hand calcium binding domain
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000293355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002902.2-1023s21c1
Sequence:CCGGGCGCTTCATCTAATTGATGAACTCGAGTTCATCAATTAGATGAAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002902.2-721s21c1
Sequence:CCGGCCGGTTTGAGTCTTGAAGAATCTCGAGATTCTTCAAGACTCAAACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002902.1-566s1c1
Sequence:CCGGCCGGTTTGAGTCTTGAAGAATCTCGAGATTCTTCAAGACTCAAACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002902.1-439s1c1
Sequence:CCGGCAGATGTATGATCGTGTGATTCTCGAGAATCACACGATCATACATCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002902.1-826s1c1
Sequence:CCGGCCTTGGGTAGTACCTAATAATCTCGAGATTATTAGGTACTACCCAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002902.1-868s1c1
Sequence:CCGGGCGCTTCATCTAATTGATGAACTCGAGTTCATCAATTAGATGAAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002902.1-513s1c1
Sequence:CCGGGCTTCACTTAAAGGACAAGAACTCGAGTTCTTGTCCTTTAAGTGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002902.2-981s21c1
Sequence:CCGGCCTTGGGTAGTACCTAATAATCTCGAGATTATTAGGTACTACCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002902.2-668s21c1
Sequence:CCGGGCTTCACTTAAAGGACAAGAACTCGAGTTCTTGTCCTTTAAGTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002902.2-594s21c1
Sequence:CCGGCAGATGTATGATCGTGTGATTCTCGAGAATCACACGATCATACATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002902
VALIDATED
RCN2 MISSION shRNA shRNA Plasmid DNA
reticulocalbin 2, EF-hand calcium binding domain
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000293355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002902.2-1023s21c1
Sequence:CCGGGCGCTTCATCTAATTGATGAACTCGAGTTCATCAATTAGATGAAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002902.2-721s21c1
Sequence:CCGGCCGGTTTGAGTCTTGAAGAATCTCGAGATTCTTCAAGACTCAAACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002902.1-566s1c1
Sequence:CCGGCCGGTTTGAGTCTTGAAGAATCTCGAGATTCTTCAAGACTCAAACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002902.1-439s1c1
Sequence:CCGGCAGATGTATGATCGTGTGATTCTCGAGAATCACACGATCATACATCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002902.1-826s1c1
Sequence:CCGGCCTTGGGTAGTACCTAATAATCTCGAGATTATTAGGTACTACCCAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002902.1-868s1c1
Sequence:CCGGGCGCTTCATCTAATTGATGAACTCGAGTTCATCAATTAGATGAAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002902.1-513s1c1
Sequence:CCGGGCTTCACTTAAAGGACAAGAACTCGAGTTCTTGTCCTTTAAGTGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002902.2-981s21c1
Sequence:CCGGCCTTGGGTAGTACCTAATAATCTCGAGATTATTAGGTACTACCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002902.2-668s21c1
Sequence:CCGGGCTTCACTTAAAGGACAAGAACTCGAGTTCTTGTCCTTTAAGTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002902.2-594s21c1
Sequence:CCGGCAGATGTATGATCGTGTGATTCTCGAGAATCACACGATCATACATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002902
VALIDATED
RCN2 MISSION shRNA Lentiviral Transduction Particles
reticulocalbin 2, EF-hand calcium binding domain
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000293355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002902.2-1023s21c1
Sequence:CCGGGCGCTTCATCTAATTGATGAACTCGAGTTCATCAATTAGATGAAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002902.2-721s21c1
Sequence:CCGGCCGGTTTGAGTCTTGAAGAATCTCGAGATTCTTCAAGACTCAAACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002902.1-566s1c1
Sequence:CCGGCCGGTTTGAGTCTTGAAGAATCTCGAGATTCTTCAAGACTCAAACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002902.1-439s1c1
Sequence:CCGGCAGATGTATGATCGTGTGATTCTCGAGAATCACACGATCATACATCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002902.1-826s1c1
Sequence:CCGGCCTTGGGTAGTACCTAATAATCTCGAGATTATTAGGTACTACCCAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002902.1-868s1c1
Sequence:CCGGGCGCTTCATCTAATTGATGAACTCGAGTTCATCAATTAGATGAAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_002902.1-513s1c1
Sequence:CCGGGCTTCACTTAAAGGACAAGAACTCGAGTTCTTGTCCTTTAAGTGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002902.2-981s21c1
Sequence:CCGGCCTTGGGTAGTACCTAATAATCTCGAGATTATTAGGTACTACCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002902.2-668s21c1
Sequence:CCGGGCTTCACTTAAAGGACAAGAACTCGAGTTCTTGTCCTTTAAGTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002902.2-594s21c1
Sequence:CCGGCAGATGTATGATCGTGTGATTCTCGAGAATCACACGATCATACATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)