EMAIL THIS PAGE TO A FRIEND

RCN3

reticulocalbin 3, EF-hand calcium binding domain

50 Gene Product Result for
Synonyms: RLP49
UniProtKB ID: Q96D15, Q9HBZ8
Gene ID:
Mouse(52377) reticulocalbin 3, EF-hand calcium binding domain
Rat(494125) reticulocalbin 3, EF-hand calcium binding domain
naked mole-rat(101726129) reticulocalbin 3, EF-hand calcium binding domain
domestic guinea pig(100726638) reticulocalbin 3, EF-hand calcium binding domain
cow(522073) reticulocalbin 3, EF-hand calcium binding domain
sheep(101106617) reticulocalbin 3, EF-hand calcium binding domain
Zebrafish(415248) reticulocalbin 3, EF-hand calcium binding domain
dog(484379) reticulocalbin 3, EF-hand calcium binding domain
domestic cat(101081269) reticulocalbin 3, EF-hand calcium binding domain
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020650 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020650 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020650 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026555 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026555 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026555 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020650 Rosetta Predictions human pricing
NM_001008694 Rosetta Predictions rat pricing
NM_026555 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192374 predicted 871
2 SASI_Hs01_00192375 predicted 1346
3 SASI_Hs01_00192376 predicted 1347
4 SASI_Hs01_00192377 predicted 870
5 SASI_Hs01_00192378 predicted 1530
6 SASI_Hs01_00192379 predicted 1350
7 SASI_Hs01_00192380 predicted 948
8 SASI_Hs01_00192381 predicted 637
9 SASI_Hs01_00192382 predicted 1044
10 SASI_Hs02_00353627 predicted 627
11 SASI_Hs01_00192383 predicted 1041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008694 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068101 predicted 234
2 SASI_Rn01_00068102 predicted 519
3 SASI_Rn01_00068103 predicted 430
4 SASI_Rn01_00068104 predicted 286
5 SASI_Rn01_00068105 predicted 605
6 SASI_Rn01_00068106 predicted 751
7 SASI_Rn01_00068107 predicted 338
8 SASI_Rn01_00068109 predicted 233
9 SASI_Rn02_00199244 predicted 703
10 SASI_Rn02_00199245 predicted 997
11 SASI_Rn01_00068108 predicted 518
12 SASI_Rn01_00068110 predicted 656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026555 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126005 predicted 1072
2 SASI_Mm01_00126006 predicted 531
3 SASI_Mm01_00126007 predicted 554
4 SASI_Mm01_00126008 predicted 455
5 SASI_Mm01_00126009 predicted 786
6 SASI_Mm01_00126010 predicted 775
7 SASI_Mm01_00126011 predicted 726
8 SASI_Mm01_00126012 predicted 540
9 SASI_Mm01_00126013 predicted 864
10 SASI_Mm01_00126014 predicted 1192
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020650
VALIDATED
RCN3 MISSION shRNA Bacterial Glycerol Stock
reticulocalbin 3, EF-hand calcium binding domain
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020650.2-1332s21c1
Sequence:CCGGGCGGCTGAGCAAAGCGGAAATCTCGAGATTTCCGCTTTGCTCAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020650.2-1353s21c1
Sequence:CCGGCCTGGGTAATTGGAACATGTTCTCGAGAACATGTTCCAATTACCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020650.2-641s21c1
Sequence:CCGGCCAAGGAATTCGACCAACTCACTCGAGTGAGTTGGTCGAATTCCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020650.2-898s21c1
Sequence:CCGGGAATTTCATGACGTGGAGGATCTCGAGATCCTCCACGTCATGAAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020650.2-1353s1c1
Sequence:CCGGCCTGGGTAATTGGAACATGTTCTCGAGAACATGTTCCAATTACCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_020650.2-641s1c1
Sequence:CCGGCCAAGGAATTCGACCAACTCACTCGAGTGAGTTGGTCGAATTCCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020650.2-898s1c1
Sequence:CCGGGAATTTCATGACGTGGAGGATCTCGAGATCCTCCACGTCATGAAATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020650.2-1332s1c1
Sequence:CCGGGCGGCTGAGCAAAGCGGAAATCTCGAGATTTCCGCTTTGCTCAGCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_020650.2-1084s1c1
Sequence:CCGGGACAGAAACAAAGATGGCTATCTCGAGATAGCCATCTTTGTTTCTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020650
VALIDATED
RCN3 MISSION shRNA shRNA Plasmid DNA
reticulocalbin 3, EF-hand calcium binding domain
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020650.2-1332s21c1
Sequence:CCGGGCGGCTGAGCAAAGCGGAAATCTCGAGATTTCCGCTTTGCTCAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020650.2-1353s21c1
Sequence:CCGGCCTGGGTAATTGGAACATGTTCTCGAGAACATGTTCCAATTACCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020650.2-641s21c1
Sequence:CCGGCCAAGGAATTCGACCAACTCACTCGAGTGAGTTGGTCGAATTCCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020650.2-898s21c1
Sequence:CCGGGAATTTCATGACGTGGAGGATCTCGAGATCCTCCACGTCATGAAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020650.2-1353s1c1
Sequence:CCGGCCTGGGTAATTGGAACATGTTCTCGAGAACATGTTCCAATTACCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_020650.2-641s1c1
Sequence:CCGGCCAAGGAATTCGACCAACTCACTCGAGTGAGTTGGTCGAATTCCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020650.2-898s1c1
Sequence:CCGGGAATTTCATGACGTGGAGGATCTCGAGATCCTCCACGTCATGAAATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020650.2-1332s1c1
Sequence:CCGGGCGGCTGAGCAAAGCGGAAATCTCGAGATTTCCGCTTTGCTCAGCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_020650.2-1084s1c1
Sequence:CCGGGACAGAAACAAAGATGGCTATCTCGAGATAGCCATCTTTGTTTCTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020650
VALIDATED
RCN3 MISSION shRNA Lentiviral Transduction Particles
reticulocalbin 3, EF-hand calcium binding domain
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020650.2-1332s21c1
Sequence:CCGGGCGGCTGAGCAAAGCGGAAATCTCGAGATTTCCGCTTTGCTCAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020650.2-1353s21c1
Sequence:CCGGCCTGGGTAATTGGAACATGTTCTCGAGAACATGTTCCAATTACCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020650.2-641s21c1
Sequence:CCGGCCAAGGAATTCGACCAACTCACTCGAGTGAGTTGGTCGAATTCCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020650.2-898s21c1
Sequence:CCGGGAATTTCATGACGTGGAGGATCTCGAGATCCTCCACGTCATGAAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020650.2-1353s1c1
Sequence:CCGGCCTGGGTAATTGGAACATGTTCTCGAGAACATGTTCCAATTACCCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_020650.2-641s1c1
Sequence:CCGGCCAAGGAATTCGACCAACTCACTCGAGTGAGTTGGTCGAATTCCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020650.2-898s1c1
Sequence:CCGGGAATTTCATGACGTGGAGGATCTCGAGATCCTCCACGTCATGAAATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020650.2-1332s1c1
Sequence:CCGGGCGGCTGAGCAAAGCGGAAATCTCGAGATTTCCGCTTTGCTCAGCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_020650.2-1084s1c1
Sequence:CCGGGACAGAAACAAAGATGGCTATCTCGAGATAGCCATCTTTGTTTCTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026555
RCN3 MISSION shRNA Bacterial Glycerol Stock
reticulocalbin 3, EF-hand calcium binding domain
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026555.1-1240s1c1
Sequence:CCGGCAGGATACTCAGGCACTCAAACTCGAGTTTGAGTGCCTGAGTATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026555.1-703s1c1
Sequence:CCGGGAGGACCTTGACAAGAACAAACTCGAGTTTGTTCTTGTCAAGGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026555.1-319s1c1
Sequence:CCGGCGGATCGTAGACCGCATGGATCTCGAGATCCATGCGGTCTACGATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026555.1-264s1c1
Sequence:CCGGCGTGGCCAAGGAATTTGACAACTCGAGTTGTCAAATTCCTTGGCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026555.1-822s1c1
Sequence:CCGGCCGAGAGTTCCGGGATCTGAACTCGAGTTCAGATCCCGGAACTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026555
RCN3 MISSION shRNA shRNA Plasmid DNA
reticulocalbin 3, EF-hand calcium binding domain
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026555.1-1240s1c1
Sequence:CCGGCAGGATACTCAGGCACTCAAACTCGAGTTTGAGTGCCTGAGTATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026555.1-703s1c1
Sequence:CCGGGAGGACCTTGACAAGAACAAACTCGAGTTTGTTCTTGTCAAGGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026555.1-319s1c1
Sequence:CCGGCGGATCGTAGACCGCATGGATCTCGAGATCCATGCGGTCTACGATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026555.1-264s1c1
Sequence:CCGGCGTGGCCAAGGAATTTGACAACTCGAGTTGTCAAATTCCTTGGCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026555.1-822s1c1
Sequence:CCGGCCGAGAGTTCCGGGATCTGAACTCGAGTTCAGATCCCGGAACTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026555
RCN3 MISSION shRNA Lentiviral Transduction Particles
reticulocalbin 3, EF-hand calcium binding domain
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026555.1-1240s1c1
Sequence:CCGGCAGGATACTCAGGCACTCAAACTCGAGTTTGAGTGCCTGAGTATCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026555.1-703s1c1
Sequence:CCGGGAGGACCTTGACAAGAACAAACTCGAGTTTGTTCTTGTCAAGGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026555.1-319s1c1
Sequence:CCGGCGGATCGTAGACCGCATGGATCTCGAGATCCATGCGGTCTACGATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026555.1-264s1c1
Sequence:CCGGCGTGGCCAAGGAATTTGACAACTCGAGTTGTCAAATTCCTTGGCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026555.1-822s1c1
Sequence:CCGGCCGAGAGTTCCGGGATCTGAACTCGAGTTCAGATCCCGGAACTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)