EMAIL THIS PAGE TO A FRIEND

RCOR1

REST corepressor 1

222 Gene Product Result for
Synonyms: COREST RCOR
UniProtKB ID: Q9UKL0, Q15044, Q6P2I9, Q86VG5
Gene ID:
Human(23186) Summary: This gene encodes a protein that is well-conserved, downregulated at birth, and with a specific role in determining neural cell differentiation. The encoded protein binds to the C-terminal domain of REST (repressor element-1 silencing transcription factor). [provided by RefSeq, Aug 2011]
Mouse(217864) REST corepressor 1
Rat(314458) REST corepressor 1
Zebrafish(569294) REST corepressor 1
dog(612620) REST corepressor 1
Horse(100058618) REST corepressor 1
domestic cat(101083857) REST corepressor 1
chicken(428911) REST corepressor 1
cow(506525) REST corepressor 1
sheep(101121973) REST corepressor 1
domestic guinea pig(100734211) REST corepressor 1
naked mole-rat(101719777) REST corepressor 1
Domestic Rabbit(100355738) REST corepressor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198023 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198023 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198023 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015156 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015156 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015156 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015156 Rosetta Predictions human pricing
NM_001108060 Rosetta Predictions rat pricing
NM_198023 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015156 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347113 predicted 1179
2 SASI_Hs02_00347114 predicted 505
3 SASI_Hs02_00347115 predicted 1486
4 SASI_Hs01_00113812 predicted 1167
5 SASI_Hs01_00113814 predicted 533
6 SASI_Hs01_00113817 predicted 1224
7 SASI_Hs02_00347116 predicted 587
8 SASI_Hs02_00347117 predicted 1369
9 SASI_Hs02_00347118 predicted 645
10 SASI_Hs02_00347119 predicted 1340
11 SASI_Hs01_00113808 predicted 1208
12 SASI_Hs01_00113809 predicted 535
13 SASI_Hs01_00113810 predicted 1222
14 SASI_Hs01_00113811 predicted 398
15 SASI_Hs01_00113813 predicted 422
16 SASI_Hs01_00113815 predicted 493
17 SASI_Hs01_00113816 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108060 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234955 predicted 1589
2 SASI_Rn02_00234956 predicted 1551
3 SASI_Rn02_00234957 predicted 1472
4 SASI_Rn02_00234958 predicted 1696
5 SASI_Rn02_00234959 predicted 1843
6 SASI_Rn02_00234960 predicted 1739
7 SASI_Rn02_00234961 predicted 1926
8 SASI_Rn02_00234962 predicted 1870
9 SASI_Rn02_00234963 predicted 1715
10 SASI_Rn02_00234964 predicted 1616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198023 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090332 predicted 300
2 SASI_Mm01_00090333 predicted 1281
3 SASI_Mm01_00090335 predicted 237
4 SASI_Mm02_00350747 predicted 1295
5 SASI_Mm01_00090336 predicted 1105
6 SASI_Mm01_00090337 predicted 1143
7 SASI_Mm01_00090338 predicted 444
8 SASI_Mm01_00090339 predicted 978
9 SASI_Mm01_00090340 predicted 355
10 SASI_Mm01_00090341 predicted 387
11 SASI_Mm01_00090334 predicted 305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198023
VALIDATED
RCOR1 MISSION shRNA Bacterial Glycerol Stock
REST corepressor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000301883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198023.2-166s21c1
Sequence:CCGGCGCAGTCAAGAACGAGACAATCTCGAGATTGTCTCGTTCTTGACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198023.2-1075s21c1
Sequence:CCGGCGCCGCTTCAACATAGATGAACTCGAGTTCATCTATGTTGAAGCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198023.2-391s21c1
Sequence:CCGGGTCTTATTTGAGCAAGCCTTTCTCGAGAAAGGCTTGCTCAAATAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198023.1-826s1c1
Sequence:CCGGGTCTCCATCAAACGACAGATTCTCGAGAATCTGTCGTTTGATGGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198023.1-583s1c1
Sequence:CCGGGAAGAAACAAACGGCAGTAATCTCGAGATTACTGCCGTTTGTTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198023.1-166s1c1
Sequence:CCGGCGCAGTCAAGAACGAGACAATCTCGAGATTGTCTCGTTCTTGACTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198023.1-391s1c1
Sequence:CCGGGTCTTATTTGAGCAAGCCTTTCTCGAGAAAGGCTTGCTCAAATAAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198023.1-1075s1c1
Sequence:CCGGCGCCGCTTCAACATAGATGAACTCGAGTTCATCTATGTTGAAGCGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198023.2-583s21c1
Sequence:CCGGGAAGAAACAAACGGCAGTAATCTCGAGATTACTGCCGTTTGTTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198023.2-826s21c1
Sequence:CCGGGTCTCCATCAAACGACAGATTCTCGAGAATCTGTCGTTTGATGGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198023
VALIDATED
RCOR1 MISSION shRNA shRNA Plasmid DNA
REST corepressor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000301883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198023.2-166s21c1
Sequence:CCGGCGCAGTCAAGAACGAGACAATCTCGAGATTGTCTCGTTCTTGACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198023.2-1075s21c1
Sequence:CCGGCGCCGCTTCAACATAGATGAACTCGAGTTCATCTATGTTGAAGCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198023.2-391s21c1
Sequence:CCGGGTCTTATTTGAGCAAGCCTTTCTCGAGAAAGGCTTGCTCAAATAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198023.1-826s1c1
Sequence:CCGGGTCTCCATCAAACGACAGATTCTCGAGAATCTGTCGTTTGATGGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198023.1-583s1c1
Sequence:CCGGGAAGAAACAAACGGCAGTAATCTCGAGATTACTGCCGTTTGTTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198023.1-166s1c1
Sequence:CCGGCGCAGTCAAGAACGAGACAATCTCGAGATTGTCTCGTTCTTGACTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198023.1-391s1c1
Sequence:CCGGGTCTTATTTGAGCAAGCCTTTCTCGAGAAAGGCTTGCTCAAATAAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198023.1-1075s1c1
Sequence:CCGGCGCCGCTTCAACATAGATGAACTCGAGTTCATCTATGTTGAAGCGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198023.2-583s21c1
Sequence:CCGGGAAGAAACAAACGGCAGTAATCTCGAGATTACTGCCGTTTGTTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198023.2-826s21c1
Sequence:CCGGGTCTCCATCAAACGACAGATTCTCGAGAATCTGTCGTTTGATGGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198023
VALIDATED
RCOR1 MISSION shRNA Lentiviral Transduction Particles
REST corepressor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000301883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198023.2-166s21c1
Sequence:CCGGCGCAGTCAAGAACGAGACAATCTCGAGATTGTCTCGTTCTTGACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198023.2-1075s21c1
Sequence:CCGGCGCCGCTTCAACATAGATGAACTCGAGTTCATCTATGTTGAAGCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198023.2-391s21c1
Sequence:CCGGGTCTTATTTGAGCAAGCCTTTCTCGAGAAAGGCTTGCTCAAATAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198023.1-826s1c1
Sequence:CCGGGTCTCCATCAAACGACAGATTCTCGAGAATCTGTCGTTTGATGGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198023.1-583s1c1
Sequence:CCGGGAAGAAACAAACGGCAGTAATCTCGAGATTACTGCCGTTTGTTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198023.1-166s1c1
Sequence:CCGGCGCAGTCAAGAACGAGACAATCTCGAGATTGTCTCGTTCTTGACTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198023.1-391s1c1
Sequence:CCGGGTCTTATTTGAGCAAGCCTTTCTCGAGAAAGGCTTGCTCAAATAAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_198023.1-1075s1c1
Sequence:CCGGCGCCGCTTCAACATAGATGAACTCGAGTTCATCTATGTTGAAGCGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198023.2-583s21c1
Sequence:CCGGGAAGAAACAAACGGCAGTAATCTCGAGATTACTGCCGTTTGTTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198023.2-826s21c1
Sequence:CCGGGTCTCCATCAAACGACAGATTCTCGAGAATCTGTCGTTTGATGGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015156
VALIDATED
RCOR1 MISSION shRNA Bacterial Glycerol Stock
REST corepressor 1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015156.1-1035s1c1
Sequence:CCGGCAAACGACAGATCCAGAATATCTCGAGATATTCTGGATCTGTCGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015156.1-790s1c1
Sequence:CCGGGCAAATGGAAACAATCCCATTCTCGAGAATGGGATTGTTTCCATTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015156.1-1090s1c1
Sequence:CCGGGATGGTGGAATAGAACCATATCTCGAGATATGGTTCTATTCCACCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015156.1-184s1c1
Sequence:CCGGCCCAATAATGGCCAGAATAAACTCGAGTTTATTCTGGCCATTATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015156.1-1118s1c1
Sequence:CCGGCAGAGGTCATTCAGAAATGTACTCGAGTACATTTCTGAATGACCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015156.2-1590s21c1
Sequence:CCGGGTGCTCCATCTGCCTTAATTCCTCGAGGAATTAAGGCAGATGGAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015156.2-1921s21c1
Sequence:CCGGACAACCACCTAAGTGATAATACTCGAGTATTATCACTTAGGTGGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015156.1-592s1c1
Sequence:CCGGGTCTTATTTGAGCAAGCCTTTCTCGAGAAAGGCTTGCTCAAATAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015156.1-665s1c1
Sequence:CCGGCTATAGCAAGTCTGGTGAAATCTCGAGATTTCACCAGACTTGCTATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015156.1-435s1c1
Sequence:CCGGGTTGGATGAATACATTGCCATCTCGAGATGGCAATGTATTCATCCAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015156.1-1060s1c1
Sequence:CCGGCAGACAAACAGTGCTCTCAAACTCGAGTTTGAGAGCACTGTTTGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015156.2-1011s21c1
Sequence:CCGGACTAGACATGGAATTGGTTTCCTCGAGGAAACCAATTCCATGTCTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015156.2-1061s21c1
Sequence:CCGGAGACAAACAGTGCTCTCAAAGCTCGAGCTTTGAGAGCACTGTTTGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015156.2-497s21c1
Sequence:CCGGGGATGCTCTTCTGGCATAAACCTCGAGGTTTATGCCAGAAGAGCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015156.2-1490s21c1
Sequence:CCGGTATCCGGGATATCAGGTATTACTCGAGTAATACCTGATATCCCGGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015156
VALIDATED
RCOR1 MISSION shRNA shRNA Plasmid DNA
REST corepressor 1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015156.1-1035s1c1
Sequence:CCGGCAAACGACAGATCCAGAATATCTCGAGATATTCTGGATCTGTCGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015156.1-790s1c1
Sequence:CCGGGCAAATGGAAACAATCCCATTCTCGAGAATGGGATTGTTTCCATTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000128570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015156.1-1090s1c1
Sequence:CCGGGATGGTGGAATAGAACCATATCTCGAGATATGGTTCTATTCCACCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015156.1-184s1c1
Sequence:CCGGCCCAATAATGGCCAGAATAAACTCGAGTTTATTCTGGCCATTATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015156.1-1118s1c1
Sequence:CCGGCAGAGGTCATTCAGAAATGTACTCGAGTACATTTCTGAATGACCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015156.2-1590s21c1
Sequence:CCGGGTGCTCCATCTGCCTTAATTCCTCGAGGAATTAAGGCAGATGGAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015156.2-1921s21c1
Sequence:CCGGACAACCACCTAAGTGATAATACTCGAGTATTATCACTTAGGTGGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015156.1-592s1c1
Sequence:CCGGGTCTTATTTGAGCAAGCCTTTCTCGAGAAAGGCTTGCTCAAATAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015156.1-665s1c1
Sequence:CCGGCTATAGCAAGTCTGGTGAAATCTCGAGATTTCACCAGACTTGCTATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015156.1-435s1c1
Sequence:CCGGGTTGGATGAATACATTGCCATCTCGAGATGGCAATGTATTCATCCAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015156.1-1060s1c1
Sequence:CCGGCAGACAAACAGTGCTCTCAAACTCGAGTTTGAGAGCACTGTTTGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015156.2-1011s21c1
Sequence:CCGGACTAGACATGGAATTGGTTTCCTCGAGGAAACCAATTCCATGTCTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015156.2-1061s21c1
Sequence:CCGGAGACAAACAGTGCTCTCAAAGCTCGAGCTTTGAGAGCACTGTTTGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015156.2-497s21c1
Sequence:CCGGGGATGCTCTTCTGGCATAAACCTCGAGGTTTATGCCAGAAGAGCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015156.2-1490s21c1
Sequence:CCGGTATCCGGGATATCAGGTATTACTCGAGTAATACCTGATATCCCGGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015156
VALIDATED
RCOR1 MISSION shRNA Lentiviral Transduction Particles
REST corepressor 1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015156.1-1035s1c1
Sequence:CCGGCAAACGACAGATCCAGAATATCTCGAGATATTCTGGATCTGTCGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015156.1-790s1c1
Sequence:CCGGGCAAATGGAAACAATCCCATTCTCGAGAATGGGATTGTTTCCATTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000128570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015156.1-1090s1c1
Sequence:CCGGGATGGTGGAATAGAACCATATCTCGAGATATGGTTCTATTCCACCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015156.1-184s1c1
Sequence:CCGGCCCAATAATGGCCAGAATAAACTCGAGTTTATTCTGGCCATTATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015156.1-1118s1c1
Sequence:CCGGCAGAGGTCATTCAGAAATGTACTCGAGTACATTTCTGAATGACCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015156.2-1590s21c1
Sequence:CCGGGTGCTCCATCTGCCTTAATTCCTCGAGGAATTAAGGCAGATGGAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418894    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015156.2-1921s21c1
Sequence:CCGGACAACCACCTAAGTGATAATACTCGAGTATTATCACTTAGGTGGTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015156.1-592s1c1
Sequence:CCGGGTCTTATTTGAGCAAGCCTTTCTCGAGAAAGGCTTGCTCAAATAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015156.1-665s1c1
Sequence:CCGGCTATAGCAAGTCTGGTGAAATCTCGAGATTTCACCAGACTTGCTATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015156.1-435s1c1
Sequence:CCGGGTTGGATGAATACATTGCCATCTCGAGATGGCAATGTATTCATCCAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149968    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015156.1-1060s1c1
Sequence:CCGGCAGACAAACAGTGCTCTCAAACTCGAGTTTGAGAGCACTGTTTGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015156.2-1011s21c1
Sequence:CCGGACTAGACATGGAATTGGTTTCCTCGAGGAAACCAATTCCATGTCTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414931    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015156.2-1061s21c1
Sequence:CCGGAGACAAACAGTGCTCTCAAAGCTCGAGCTTTGAGAGCACTGTTTGTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015156.2-497s21c1
Sequence:CCGGGGATGCTCTTCTGGCATAAACCTCGAGGTTTATGCCAGAAGAGCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425035    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015156.2-1490s21c1
Sequence:CCGGTATCCGGGATATCAGGTATTACTCGAGTAATACCTGATATCCCGGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)