EMAIL THIS PAGE TO A FRIEND

RCOR3

REST corepressor 3

191 Gene Product Result for
Synonyms: RP11-318L16.1
Gene ID:
Mouse(214742) REST corepressor 3
Rat(684192) REST corepressor 3
domestic guinea pig(100731948) REST corepressor 3
naked mole-rat(101705241) REST corepressor 3
cow(532635) REST corepressor 3
sheep(101119921) REST corepressor 3
Zebrafish(563808) REST corepressor 3
chicken(421380) REST corepressor 3
domestic cat(101086444) REST corepressor 3
Horse(100051147) REST corepressor 3
dog(480018) REST corepressor 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018254 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018254 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018254 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144814 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144814 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144814 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018254 Rosetta Predictions human pricing
NM_001134985 Rosetta Predictions rat pricing
NM_144814 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00225444 predicted 772
2 SASI_Hs01_00225445 predicted 717
3 SASI_Hs01_00225446 predicted 313
4 SASI_Hs01_00225447 predicted 729
5 SASI_Hs01_00225448 predicted 323
6 SASI_Hs01_00225449 predicted 743
7 SASI_Hs01_00225450 predicted 667
8 SASI_Hs01_00225451 predicted 906
9 SASI_Hs01_00225452 predicted 410
10 SASI_Hs02_00351607 predicted 629
11 SASI_Hs01_00225453 predicted 1168
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134985 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259254 predicted 690
2 SASI_Rn02_00259255 predicted 379
3 SASI_Rn02_00259256 predicted 656
4 SASI_Rn02_00259257 predicted 691
5 SASI_Rn02_00259258 predicted 491
6 SASI_Rn02_00259259 predicted 460
7 SASI_Rn02_00259260 predicted 680
8 SASI_Rn02_00259261 predicted 481
9 SASI_Rn02_00259262 predicted 987
10 SASI_Rn02_00259263 predicted 1370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144814 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129816 predicted 391
2 SASI_Mm01_00129817 predicted 1215
3 SASI_Mm01_00129818 predicted 238
4 SASI_Mm02_00340174 predicted 420
5 SASI_Mm01_00129820 predicted 1244
6 SASI_Mm01_00129821 predicted 405
7 SASI_Mm01_00129822 predicted 1258
8 SASI_Mm01_00129823 predicted 827
9 SASI_Mm01_00129824 predicted 1282
10 SASI_Mm01_00129825 predicted 802
11 SASI_Mm01_00129819 predicted 423
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018254
VALIDATED
RCOR3 MISSION shRNA Bacterial Glycerol Stock
REST corepressor 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018254.2-353s1c1
Sequence:CCGGCCCTTGCTGATCTCCCTAATTCTCGAGAATTAGGGAGATCAGCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018254.2-3325s1c1
Sequence:CCGGGCCCTGAATTTAGCTGATTTACTCGAGTAAATCAGCTAAATTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018254.3-1097s21c1
Sequence:CCGGCAAGCTATTGCAGATGTAATTCTCGAGAATTACATCTGCAATAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018254.2-1034s1c1
Sequence:CCGGTCCGCAAATATGGTAAAGATTCTCGAGAATCTTTACCATATTTGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018254.2-1035s1c1
Sequence:CCGGCCGCAAATATGGTAAAGATTTCTCGAGAAATCTTTACCATATTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018254.2-1566s1c1
Sequence:CCGGGCCACCATCACTTATTGGAATCTCGAGATTCCAATAAGTGATGGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018254.3-2013s21c1
Sequence:CCCGGCTCTTAGTACAGGAATATTGCTCGAGCAATATTCCTGTACTAAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018254.3-566s21c1
Sequence:CCGGACTCGCTCTAGGACAAGTTTGCTCGAGCAAACTTGTCCTAGAGCGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018254.3-509s21c1
Sequence:CCGGATGCTTCCAGATAAGACAATTCTCGAGAATTGTCTTATCTGGAAGCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018254.3-1862s21c1
Sequence:CCGGTAGCCTCCTTTCTAGAGTATACTCGAGTATACTCTAGAAAGGAGGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018254.3-357s21c1
Sequence:CCGGGCATGTTGTTCTGGCATAAACCTCGAGGTTTATGCCAGAACAACATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018254.3-277s21c1
Sequence:CCGGCAGTATCCCAGATGCCAAATTCTCGAGAATTTGGCATCTGGGATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018254
VALIDATED
RCOR3 MISSION shRNA shRNA Plasmid DNA
REST corepressor 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018254.2-353s1c1
Sequence:CCGGCCCTTGCTGATCTCCCTAATTCTCGAGAATTAGGGAGATCAGCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018254.2-3325s1c1
Sequence:CCGGGCCCTGAATTTAGCTGATTTACTCGAGTAAATCAGCTAAATTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018254.3-1097s21c1
Sequence:CCGGCAAGCTATTGCAGATGTAATTCTCGAGAATTACATCTGCAATAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018254.2-1034s1c1
Sequence:CCGGTCCGCAAATATGGTAAAGATTCTCGAGAATCTTTACCATATTTGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018254.2-1035s1c1
Sequence:CCGGCCGCAAATATGGTAAAGATTTCTCGAGAAATCTTTACCATATTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018254.2-1566s1c1
Sequence:CCGGGCCACCATCACTTATTGGAATCTCGAGATTCCAATAAGTGATGGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018254.3-2013s21c1
Sequence:CCCGGCTCTTAGTACAGGAATATTGCTCGAGCAATATTCCTGTACTAAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018254.3-566s21c1
Sequence:CCGGACTCGCTCTAGGACAAGTTTGCTCGAGCAAACTTGTCCTAGAGCGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018254.3-509s21c1
Sequence:CCGGATGCTTCCAGATAAGACAATTCTCGAGAATTGTCTTATCTGGAAGCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018254.3-1862s21c1
Sequence:CCGGTAGCCTCCTTTCTAGAGTATACTCGAGTATACTCTAGAAAGGAGGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018254.3-357s21c1
Sequence:CCGGGCATGTTGTTCTGGCATAAACCTCGAGGTTTATGCCAGAACAACATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018254.3-277s21c1
Sequence:CCGGCAGTATCCCAGATGCCAAATTCTCGAGAATTTGGCATCTGGGATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018254
VALIDATED
RCOR3 MISSION shRNA Lentiviral Transduction Particles
REST corepressor 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116089    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018254.2-353s1c1
Sequence:CCGGCCCTTGCTGATCTCCCTAATTCTCGAGAATTAGGGAGATCAGCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116087    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018254.2-3325s1c1
Sequence:CCGGGCCCTGAATTTAGCTGATTTACTCGAGTAAATCAGCTAAATTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018254.3-1097s21c1
Sequence:CCGGCAAGCTATTGCAGATGTAATTCTCGAGAATTACATCTGCAATAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018254.2-1034s1c1
Sequence:CCGGTCCGCAAATATGGTAAAGATTCTCGAGAATCTTTACCATATTTGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018254.2-1035s1c1
Sequence:CCGGCCGCAAATATGGTAAAGATTTCTCGAGAAATCTTTACCATATTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018254.2-1566s1c1
Sequence:CCGGGCCACCATCACTTATTGGAATCTCGAGATTCCAATAAGTGATGGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018254.3-2013s21c1
Sequence:CCCGGCTCTTAGTACAGGAATATTGCTCGAGCAATATTCCTGTACTAAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018254.3-566s21c1
Sequence:CCGGACTCGCTCTAGGACAAGTTTGCTCGAGCAAACTTGTCCTAGAGCGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018254.3-509s21c1
Sequence:CCGGATGCTTCCAGATAAGACAATTCTCGAGAATTGTCTTATCTGGAAGCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413313    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018254.3-1862s21c1
Sequence:CCGGTAGCCTCCTTTCTAGAGTATACTCGAGTATACTCTAGAAAGGAGGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018254.3-357s21c1
Sequence:CCGGGCATGTTGTTCTGGCATAAACCTCGAGGTTTATGCCAGAACAACATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018254.3-277s21c1
Sequence:CCGGCAGTATCCCAGATGCCAAATTCTCGAGAATTTGGCATCTGGGATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144814
VALIDATED
RCOR3 MISSION shRNA Bacterial Glycerol Stock
REST corepressor 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126689    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144814.2-1249s1c1
Sequence:CCGGCGCTGGACAAAGGCTCACCTACTCGAGTAGGTGAGCCTTTGTCCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144814.2-157s1c1
Sequence:CCGGCCTTATCACAGTATCCCAGATCTCGAGATCTGGGATACTGTGATAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144814.2-837s1c1
Sequence:CCGGGCAAGTAAACAGTGCACTTAACTCGAGTTAAGTGCACTGTTTACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144814.2-1195s1c1
Sequence:CCGGCCACCTTCACTCATTGGGATTCTCGAGAATCCCAATGAGTGAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144814.2-113s1c1
Sequence:CCGGCCAAGTACACAGATAAAGACACTCGAGTGTCTTTATCTGTGTACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144814
VALIDATED
RCOR3 MISSION shRNA shRNA Plasmid DNA
REST corepressor 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126689    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144814.2-1249s1c1
Sequence:CCGGCGCTGGACAAAGGCTCACCTACTCGAGTAGGTGAGCCTTTGTCCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144814.2-157s1c1
Sequence:CCGGCCTTATCACAGTATCCCAGATCTCGAGATCTGGGATACTGTGATAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144814.2-837s1c1
Sequence:CCGGGCAAGTAAACAGTGCACTTAACTCGAGTTAAGTGCACTGTTTACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144814.2-1195s1c1
Sequence:CCGGCCACCTTCACTCATTGGGATTCTCGAGAATCCCAATGAGTGAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000126693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144814.2-113s1c1
Sequence:CCGGCCAAGTACACAGATAAAGACACTCGAGTGTCTTTATCTGTGTACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144814
VALIDATED
RCOR3 MISSION shRNA Lentiviral Transduction Particles
REST corepressor 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126689    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144814.2-1249s1c1
Sequence:CCGGCGCTGGACAAAGGCTCACCTACTCGAGTAGGTGAGCCTTTGTCCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144814.2-157s1c1
Sequence:CCGGCCTTATCACAGTATCCCAGATCTCGAGATCTGGGATACTGTGATAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144814.2-837s1c1
Sequence:CCGGGCAAGTAAACAGTGCACTTAACTCGAGTTAAGTGCACTGTTTACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126690    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144814.2-1195s1c1
Sequence:CCGGCCACCTTCACTCATTGGGATTCTCGAGAATCCCAATGAGTGAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000126693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144814.2-113s1c1
Sequence:CCGGCCAAGTACACAGATAAAGACACTCGAGTGTCTTTATCTGTGTACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)