EMAIL THIS PAGE TO A FRIEND

RCSD1

RCSD domain containing 1

115 Gene Product Result for
Synonyms: CAPZIP MK2S4
Gene ID:
Mouse(226594) RCSD domain containing 1
Rat(360872) RCSD domain containing 1
cow(512205) RCSD domain containing 1
sheep(101115084) RCSD domain containing 1
domestic guinea pig(100713093) RCSD domain containing 1
naked mole-rat(101723922) RCSD domain containing 1
chicken(418443) RCSD domain containing 1
domestic cat(101080857) RCSD domain containing 1
dog(480089) RCSD domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052862 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052862 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052862 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178593 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178593 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178593 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052862 Rosetta Predictions human pricing
NM_001108349 Rosetta Predictions rat pricing
NM_001038846 Rosetta Predictions mouse pricing
NM_178593 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214098 predicted 778
2 SASI_Hs01_00214099 predicted 934
3 SASI_Hs01_00214100 predicted 585
4 SASI_Hs01_00214101 predicted 328
5 SASI_Hs01_00214102 predicted 659
6 SASI_Hs01_00214103 predicted 1743
7 SASI_Hs01_00214104 predicted 566
8 SASI_Hs02_00361557 predicted 879
9 SASI_Hs01_00214105 predicted 1601
10 SASI_Hs01_00214106 predicted 943
11 SASI_Hs01_00214107 predicted 1313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108349 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237789 predicted 355
2 SASI_Rn02_00237790 predicted 941
3 SASI_Rn02_00237791 predicted 526
4 SASI_Rn02_00237792 predicted 960
5 SASI_Rn02_00237793 predicted 763
6 SASI_Rn02_00237794 predicted 1051
7 SASI_Rn02_00237795 predicted 758
8 SASI_Rn02_00237796 predicted 1438
9 SASI_Rn02_00237797 predicted 536
10 SASI_Rn02_00237798 predicted 1302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188339 predicted 1787
2 SASI_Mm01_00188340 predicted 1745
3 SASI_Mm01_00188341 predicted 1680
4 SASI_Mm01_00188342 predicted 817
5 SASI_Mm01_00188344 predicted 1155
6 SASI_Mm01_00188345 predicted 1058
7 SASI_Mm01_00188346 predicted 1679
8 SASI_Mm01_00188348 predicted 1749
9 SASI_Mm02_00289710 predicted 555
10 SASI_Mm02_00289711 predicted 816
11 SASI_Mm01_00188343 predicted 1794
12 SASI_Mm01_00188347 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178593 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125509 predicted 1871
2 SASI_Mm01_00125510 predicted 1833
3 SASI_Mm01_00125511 predicted 1771
4 SASI_Mm01_00125512 predicted 912
5 SASI_Mm01_00125514 predicted 1240
6 SASI_Mm01_00125515 predicted 1152
7 SASI_Mm01_00125516 predicted 1768
8 SASI_Mm01_00125518 predicted 1840
9 SASI_Mm02_00348917 predicted 636
10 SASI_Mm02_00348918 predicted 905
11 SASI_Mm01_00125513 predicted 1884
12 SASI_Mm01_00125517 predicted 884
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052862
VALIDATED
RCSD1 MISSION shRNA Bacterial Glycerol Stock
RCSD domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052862.3-1410s21c1
Sequence:CCGGACACTCCTGTCCAGGACACTACTCGAGTAGTGTCCTGGACAGGAGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052862.2-448s1c1
Sequence:CCGGCAGTAAACCAACCCGAAGGAACTCGAGTTCCTTCGGGTTGGTTTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052862.2-553s1c1
Sequence:CCGGGCCTCCTAAATTCAAGGTCAACTCGAGTTGACCTTGAATTTAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_052862.2-1316s1c1
Sequence:CCGGCCTGAACATGACAGCCAAGAACTCGAGTTCTTGGCTGTCATGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_052862.2-2032s1c1
Sequence:CCGGCGGTTCTCAAATATCAGTTAACTCGAGTTAACTGATATTTGAGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052862.2-523s1c1
Sequence:CCGGTGAGGAGAAATCACCACCCAACTCGAGTTGGGTGGTGATTTCTCCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052862.3-520s21c1
Sequence:CCGGCAAGGCTATGGTGTCGCCATTCTCGAGAATGGCGACACCATAGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052862.3-741s21c1
Sequence:CCGGGAGATTTCAGGGCGGTGGAGTCTCGAGACTCCACCGCCCTGAAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052862.3-797s21c1
Sequence:CCGGGATGAAGTGTTGCCATCCAAGCTCGAGCTTGGATGGCAACACTTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052862.3-401s21c1
Sequence:CCGGGCGAGCCACCCTCCTAAATTCCTCGAGGAATTTAGGAGGGTGGCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052862
VALIDATED
RCSD1 MISSION shRNA shRNA Plasmid DNA
RCSD domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052862.3-1410s21c1
Sequence:CCGGACACTCCTGTCCAGGACACTACTCGAGTAGTGTCCTGGACAGGAGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052862.2-448s1c1
Sequence:CCGGCAGTAAACCAACCCGAAGGAACTCGAGTTCCTTCGGGTTGGTTTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052862.2-553s1c1
Sequence:CCGGGCCTCCTAAATTCAAGGTCAACTCGAGTTGACCTTGAATTTAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_052862.2-1316s1c1
Sequence:CCGGCCTGAACATGACAGCCAAGAACTCGAGTTCTTGGCTGTCATGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_052862.2-2032s1c1
Sequence:CCGGCGGTTCTCAAATATCAGTTAACTCGAGTTAACTGATATTTGAGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052862.2-523s1c1
Sequence:CCGGTGAGGAGAAATCACCACCCAACTCGAGTTGGGTGGTGATTTCTCCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052862.3-520s21c1
Sequence:CCGGCAAGGCTATGGTGTCGCCATTCTCGAGAATGGCGACACCATAGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052862.3-741s21c1
Sequence:CCGGGAGATTTCAGGGCGGTGGAGTCTCGAGACTCCACCGCCCTGAAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052862.3-797s21c1
Sequence:CCGGGATGAAGTGTTGCCATCCAAGCTCGAGCTTGGATGGCAACACTTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052862.3-401s21c1
Sequence:CCGGGCGAGCCACCCTCCTAAATTCCTCGAGGAATTTAGGAGGGTGGCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052862
VALIDATED
RCSD1 MISSION shRNA Lentiviral Transduction Particles
RCSD domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052862.3-1410s21c1
Sequence:CCGGACACTCCTGTCCAGGACACTACTCGAGTAGTGTCCTGGACAGGAGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052862.2-448s1c1
Sequence:CCGGCAGTAAACCAACCCGAAGGAACTCGAGTTCCTTCGGGTTGGTTTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052862.2-553s1c1
Sequence:CCGGGCCTCCTAAATTCAAGGTCAACTCGAGTTGACCTTGAATTTAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_052862.2-1316s1c1
Sequence:CCGGCCTGAACATGACAGCCAAGAACTCGAGTTCTTGGCTGTCATGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082488    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_052862.2-2032s1c1
Sequence:CCGGCGGTTCTCAAATATCAGTTAACTCGAGTTAACTGATATTTGAGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052862.2-523s1c1
Sequence:CCGGTGAGGAGAAATCACCACCCAACTCGAGTTGGGTGGTGATTTCTCCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440948    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052862.3-520s21c1
Sequence:CCGGCAAGGCTATGGTGTCGCCATTCTCGAGAATGGCGACACCATAGCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426142    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052862.3-741s21c1
Sequence:CCGGGAGATTTCAGGGCGGTGGAGTCTCGAGACTCCACCGCCCTGAAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052862.3-797s21c1
Sequence:CCGGGATGAAGTGTTGCCATCCAAGCTCGAGCTTGGATGGCAACACTTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430269    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052862.3-401s21c1
Sequence:CCGGGCGAGCCACCCTCCTAAATTCCTCGAGGAATTTAGGAGGGTGGCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178593
RCSD1 MISSION shRNA Bacterial Glycerol Stock
RCSD domain containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178593.3-1481s21c1
Sequence:CCGGCCTTGGAAACAGCAGCAGTAACTCGAGTTACTGCTGCTGTTTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178593.3-458s21c1
Sequence:CCGGAGAAGCTTCAGGCCAACTTAGCTCGAGCTAAGTTGGCCTGAAGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178593.3-311s21c2
Sequence:CCGGCAGCCAGTAAGCCAACAAGAACTCGAGTTCTTGTTGGCTTACTGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178593.3-1282s21c1
Sequence:CCGGATCGCAGAGCCGGATACAAAGCTCGAGCTTTGTATCCGGCTCTGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178593.2-1401s1c1
Sequence:CCGGCCTTGGAAACAGCAGCAGTAACTCGAGTTACTGCTGCTGTTTCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178593.2-594s1c1
Sequence:CCGGTGCGGACTAGAGGCTCAATAACTCGAGTTATTGAGCCTCTAGTCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178593.2-451s1c1
Sequence:CCGGCAAGGCCATCATATCACCATTCTCGAGAATGGTGATATGATGGCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178593.2-231s1c1
Sequence:CCGGCAGCCAGTAAGCCAACAAGAACTCGAGTTCTTGTTGGCTTACTGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178593.2-595s1c1
Sequence:CCGGGCGGACTAGAGGCTCAATAAACTCGAGTTTATTGAGCCTCTAGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178593.3-533s21c1
Sequence:CCGGAGGCCATCGTATCACCATTTCCTCGAGGAAATGGTGATACGATGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178593
RCSD1 MISSION shRNA shRNA Plasmid DNA
RCSD domain containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178593.3-1481s21c1
Sequence:CCGGCCTTGGAAACAGCAGCAGTAACTCGAGTTACTGCTGCTGTTTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178593.3-458s21c1
Sequence:CCGGAGAAGCTTCAGGCCAACTTAGCTCGAGCTAAGTTGGCCTGAAGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178593.3-311s21c2
Sequence:CCGGCAGCCAGTAAGCCAACAAGAACTCGAGTTCTTGTTGGCTTACTGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178593.3-1282s21c1
Sequence:CCGGATCGCAGAGCCGGATACAAAGCTCGAGCTTTGTATCCGGCTCTGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178593.2-1401s1c1
Sequence:CCGGCCTTGGAAACAGCAGCAGTAACTCGAGTTACTGCTGCTGTTTCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178593.2-594s1c1
Sequence:CCGGTGCGGACTAGAGGCTCAATAACTCGAGTTATTGAGCCTCTAGTCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178593.2-451s1c1
Sequence:CCGGCAAGGCCATCATATCACCATTCTCGAGAATGGTGATATGATGGCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178593.2-231s1c1
Sequence:CCGGCAGCCAGTAAGCCAACAAGAACTCGAGTTCTTGTTGGCTTACTGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178593.2-595s1c1
Sequence:CCGGGCGGACTAGAGGCTCAATAAACTCGAGTTTATTGAGCCTCTAGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178593.3-533s21c1
Sequence:CCGGAGGCCATCGTATCACCATTTCCTCGAGGAAATGGTGATACGATGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178593
RCSD1 MISSION shRNA Lentiviral Transduction Particles
RCSD domain containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331811    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178593.3-1481s21c1
Sequence:CCGGCCTTGGAAACAGCAGCAGTAACTCGAGTTACTGCTGCTGTTTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311116    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178593.3-458s21c1
Sequence:CCGGAGAAGCTTCAGGCCAACTTAGCTCGAGCTAAGTTGGCCTGAAGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178593.3-311s21c2
Sequence:CCGGCAGCCAGTAAGCCAACAAGAACTCGAGTTCTTGTTGGCTTACTGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304686    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178593.3-1282s21c1
Sequence:CCGGATCGCAGAGCCGGATACAAAGCTCGAGCTTTGTATCCGGCTCTGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178593.2-1401s1c1
Sequence:CCGGCCTTGGAAACAGCAGCAGTAACTCGAGTTACTGCTGCTGTTTCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178593.2-594s1c1
Sequence:CCGGTGCGGACTAGAGGCTCAATAACTCGAGTTATTGAGCCTCTAGTCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178593.2-451s1c1
Sequence:CCGGCAAGGCCATCATATCACCATTCTCGAGAATGGTGATATGATGGCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178593.2-231s1c1
Sequence:CCGGCAGCCAGTAAGCCAACAAGAACTCGAGTTCTTGTTGGCTTACTGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178593.2-595s1c1
Sequence:CCGGGCGGACTAGAGGCTCAATAAACTCGAGTTTATTGAGCCTCTAGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178593.3-533s21c1
Sequence:CCGGAGGCCATCGTATCACCATTTCCTCGAGGAAATGGTGATACGATGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)