EMAIL THIS PAGE TO A FRIEND

RDH10

retinol dehydrogenase 10 (all-trans)

107 Gene Product Result for
Synonyms: SDR16C4
UniProtKB ID: Q8IZV5
Gene ID:
Human(157506) Summary: This gene encodes a retinol dehydrogenase, which converts all-trans-retinol to all-trans-retinal, with preference for NADP as a cofactor. Studies in mice suggest that this protein is essential for synthesis of embryonic retinoic acid and is required for limb, craniofacial, and organ development. [provided by RefSeq, Dec 2011]
Mouse(98711) retinol dehydrogenase 10 (all-trans)
Rat(353252) retinol dehydrogenase 10 (all-trans)
domestic guinea pig(100713440) retinol dehydrogenase 10 (all-trans)
naked mole-rat(101724742) retinol dehydrogenase 10 (all-trans)
Domestic Rabbit(100340133) retinol dehydrogenase 10 (all-trans)
cow(282852) retinol dehydrogenase 10 (all-trans)
sheep(101116487) retinol dehydrogenase 10 (all-trans)
chicken(420183) retinol dehydrogenase 10 (all-trans)
domestic cat(101081605) retinol dehydrogenase 10 (all-trans)
dog(486998) retinol dehydrogenase 10 (all-trans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133832 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133832 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133832 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_172037 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172037 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172037 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU038661 MISSION® esiRNA targeting mouse Rdh10 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172037 Rosetta Predictions human pricing
NM_181478 Rosetta Predictions rat pricing
NM_133832 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172037 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245832 predicted 736
2 SASI_Hs01_00245833 predicted 669
3 SASI_Hs01_00245834 predicted 891
4 SASI_Hs01_00245835 predicted 804
5 SASI_Hs01_00245836 predicted 749
6 SASI_Hs01_00245837 predicted 766
7 SASI_Hs01_00245838 predicted 732
8 SASI_Hs01_00245839 predicted 590
9 SASI_Hs01_00245840 predicted 505
10 SASI_Hs01_00245841 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181478 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064170 predicted 562
2 SASI_Rn01_00064171 predicted 719
3 SASI_Rn01_00064172 predicted 563
4 SASI_Rn01_00064173 predicted 393
5 SASI_Rn02_00269752 predicted 422
6 SASI_Rn01_00064174 predicted 499
7 SASI_Rn01_00064175 predicted 493
8 SASI_Rn01_00064176 predicted 237
9 SASI_Rn01_00064177 predicted 477
10 SASI_Rn02_00269753 predicted 211
11 SASI_Rn01_00064169 predicted 529
12 SASI_Rn01_00064178 predicted 530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133832 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023427 predicted 1582
2 SASI_Mm01_00023428 predicted 1522
3 SASI_Mm01_00023429 predicted 1474
4 SASI_Mm01_00023430 predicted 702
5 SASI_Mm01_00023431 predicted 1623
6 SASI_Mm01_00023432 predicted 924
7 SASI_Mm01_00023434 predicted 839
8 SASI_Mm01_00023435 predicted 1506
9 SASI_Mm01_00023436 predicted 614
10 SASI_Mm02_00338856 predicted 620
11 SASI_Mm01_00023433 predicted 763
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133832
VALIDATED
RDH10 MISSION shRNA Bacterial Glycerol Stock
retinol dehydrogenase 10 (all-trans)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133832.2-616s1c1
Sequence:CCGGGCTCATTGAAAGAACCATGATCTCGAGATCATGGTTCTTTCAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133832.2-812s1c1
Sequence:CCGGCATGAGCTAAAGGCTGCTGAACTCGAGTTCAGCAGCCTTTAGCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133832.2-680s1c1
Sequence:CCGGCCAACGATGCTAGAGATTAATCTCGAGATTAATCTCTAGCATCGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133832.2-1009s1c1
Sequence:CCGGCCTCATGTACATCGTGACATTCTCGAGAATGTCACGATGTACATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133832.3-616s21c1
Sequence:CCGGGCTCATTGAAAGAACCATGATCTCGAGATCATGGTTCTTTCAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133832.2-1875s1c1
Sequence:CCGGCCACAGAGATAATGGGAATTTCTCGAGAAATTCCCATTATCTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133832.2-1009s1c2
Sequence:CCGGCCTCATGTACATCGTGACATTCTCGAGAATGTCACGATGTACATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133832.3-1874s21c1
Sequence:CCGGCCACAGAGATAATGGGAATTTCTCGAGAAATTCCCATTATCTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133832.3-1090s21c1
Sequence:CCGGCAAGTGTATGTATCCCTTTATCTCGAGATAAAGGGATACATACACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133832.3-1058s21c1
Sequence:CCGGGTCGTGTGCATGTATCGATTTCTCGAGAAATCGATACATGCACACGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133832.3-550s21c1
Sequence:CCGGGGTCTCGGTCCTGGTCAATAACTCGAGTTATTGACCAGGACCGAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133832
VALIDATED
RDH10 MISSION shRNA shRNA Plasmid DNA
retinol dehydrogenase 10 (all-trans)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133832.2-616s1c1
Sequence:CCGGGCTCATTGAAAGAACCATGATCTCGAGATCATGGTTCTTTCAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133832.2-812s1c1
Sequence:CCGGCATGAGCTAAAGGCTGCTGAACTCGAGTTCAGCAGCCTTTAGCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133832.2-680s1c1
Sequence:CCGGCCAACGATGCTAGAGATTAATCTCGAGATTAATCTCTAGCATCGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133832.2-1009s1c1
Sequence:CCGGCCTCATGTACATCGTGACATTCTCGAGAATGTCACGATGTACATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133832.3-616s21c1
Sequence:CCGGGCTCATTGAAAGAACCATGATCTCGAGATCATGGTTCTTTCAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133832.2-1875s1c1
Sequence:CCGGCCACAGAGATAATGGGAATTTCTCGAGAAATTCCCATTATCTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133832.2-1009s1c2
Sequence:CCGGCCTCATGTACATCGTGACATTCTCGAGAATGTCACGATGTACATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133832.3-1874s21c1
Sequence:CCGGCCACAGAGATAATGGGAATTTCTCGAGAAATTCCCATTATCTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133832.3-1090s21c1
Sequence:CCGGCAAGTGTATGTATCCCTTTATCTCGAGATAAAGGGATACATACACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133832.3-1058s21c1
Sequence:CCGGGTCGTGTGCATGTATCGATTTCTCGAGAAATCGATACATGCACACGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133832.3-550s21c1
Sequence:CCGGGGTCTCGGTCCTGGTCAATAACTCGAGTTATTGACCAGGACCGAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133832
VALIDATED
RDH10 MISSION shRNA Lentiviral Transduction Particles
retinol dehydrogenase 10 (all-trans)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133832.2-616s1c1
Sequence:CCGGGCTCATTGAAAGAACCATGATCTCGAGATCATGGTTCTTTCAATGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000041956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133832.2-812s1c1
Sequence:CCGGCATGAGCTAAAGGCTGCTGAACTCGAGTTCAGCAGCCTTTAGCTCATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000041957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133832.2-680s1c1
Sequence:CCGGCCAACGATGCTAGAGATTAATCTCGAGATTAATCTCTAGCATCGTTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000041955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133832.2-1009s1c1
Sequence:CCGGCCTCATGTACATCGTGACATTCTCGAGAATGTCACGATGTACATGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000325838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133832.3-616s21c1
Sequence:CCGGGCTCATTGAAAGAACCATGATCTCGAGATCATGGTTCTTTCAATGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000041953    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133832.2-1875s1c1
Sequence:CCGGCCACAGAGATAATGGGAATTTCTCGAGAAATTCCCATTATCTCTGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000174064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133832.2-1009s1c2
Sequence:CCGGCCTCATGTACATCGTGACATTCTCGAGAATGTCACGATGTACATGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000325837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133832.3-1874s21c1
Sequence:CCGGCCACAGAGATAATGGGAATTTCTCGAGAAATTCCCATTATCTCTGTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000306057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133832.3-1090s21c1
Sequence:CCGGCAAGTGTATGTATCCCTTTATCTCGAGATAAAGGGATACATACACTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000306058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133832.3-1058s21c1
Sequence:CCGGGTCGTGTGCATGTATCGATTTCTCGAGAAATCGATACATGCACACGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000306126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133832.3-550s21c1
Sequence:CCGGGGTCTCGGTCCTGGTCAATAACTCGAGTTATTGACCAGGACCGAGACCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172037
RDH10 MISSION shRNA Bacterial Glycerol Stock
retinol dehydrogenase 10 (all-trans)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172037.2-946s1c1
Sequence:CCGGGCTGCCGAATCAGGAAAGAAACTCGAGTTTCTTTCCTGATTCGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172037.2-1180s1c1
Sequence:CCGGCCACAAACAATAATGAAGCAACTCGAGTTGCTTCATTATTGTTTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172037.2-505s1c1
Sequence:CCGGCCCACTGTAACTTGCAGGTTTCTCGAGAAACCTGCAAGTTACAGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172037.2-1061s1c1
Sequence:CCGGCCTCATGTACATCGTGACCTTCTCGAGAAGGTCACGATGTACATGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172037.3-1677s21c1
Sequence:CCGGAGTTGACATCTTCGCAATTTCCTCGAGGAAATTGCGAAGATGTCAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172037.3-816s21c1
Sequence:CCGGGAGATTAATCATGGTCATATTCTCGAGAATATGACCATGATTAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172037.3-748s21c1
Sequence:CCGGAGAGAACCATGATGGTCAATTCTCGAGAATTGACCATCATGGTTCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172037.3-972s21c1
Sequence:CCGGACAACCTTGGTTTGCCCTTATCTCGAGATAAGGGCAAACCAAGGTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172037.3-1297s21c1
Sequence:CCGGGTATGGAATATTACTTCTATCCTCGAGGATAGAAGTAATATTCCATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172037.3-1155s21c1
Sequence:CCGGATGAAGAGCATCCTACCATTTCTCGAGAAATGGTAGGATGCTCTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172037.3-1550s21c1
Sequence:CCGGCATCTTCAGGTTACCATTATTCTCGAGAATAATGGTAACCTGAAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172037
RDH10 MISSION shRNA shRNA Plasmid DNA
retinol dehydrogenase 10 (all-trans)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172037.2-946s1c1
Sequence:CCGGGCTGCCGAATCAGGAAAGAAACTCGAGTTTCTTTCCTGATTCGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172037.2-1180s1c1
Sequence:CCGGCCACAAACAATAATGAAGCAACTCGAGTTGCTTCATTATTGTTTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172037.2-505s1c1
Sequence:CCGGCCCACTGTAACTTGCAGGTTTCTCGAGAAACCTGCAAGTTACAGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172037.2-1061s1c1
Sequence:CCGGCCTCATGTACATCGTGACCTTCTCGAGAAGGTCACGATGTACATGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172037.3-1677s21c1
Sequence:CCGGAGTTGACATCTTCGCAATTTCCTCGAGGAAATTGCGAAGATGTCAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172037.3-816s21c1
Sequence:CCGGGAGATTAATCATGGTCATATTCTCGAGAATATGACCATGATTAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172037.3-748s21c1
Sequence:CCGGAGAGAACCATGATGGTCAATTCTCGAGAATTGACCATCATGGTTCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172037.3-972s21c1
Sequence:CCGGACAACCTTGGTTTGCCCTTATCTCGAGATAAGGGCAAACCAAGGTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172037.3-1297s21c1
Sequence:CCGGGTATGGAATATTACTTCTATCCTCGAGGATAGAAGTAATATTCCATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172037.3-1155s21c1
Sequence:CCGGATGAAGAGCATCCTACCATTTCTCGAGAAATGGTAGGATGCTCTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172037.3-1550s21c1
Sequence:CCGGCATCTTCAGGTTACCATTATTCTCGAGAATAATGGTAACCTGAAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172037
RDH10 MISSION shRNA Lentiviral Transduction Particles
retinol dehydrogenase 10 (all-trans)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172037.2-946s1c1
Sequence:CCGGGCTGCCGAATCAGGAAAGAAACTCGAGTTTCTTTCCTGATTCGGCAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000028635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172037.2-1180s1c1
Sequence:CCGGCCACAAACAATAATGAAGCAACTCGAGTTGCTTCATTATTGTTTGTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000028632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172037.2-505s1c1
Sequence:CCGGCCCACTGTAACTTGCAGGTTTCTCGAGAAACCTGCAAGTTACAGTGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000028645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172037.2-1061s1c1
Sequence:CCGGCCTCATGTACATCGTGACCTTCTCGAGAAGGTCACGATGTACATGAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000430014    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172037.3-1677s21c1
Sequence:CCGGAGTTGACATCTTCGCAATTTCCTCGAGGAAATTGCGAAGATGTCAACTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000426478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172037.3-816s21c1
Sequence:CCGGGAGATTAATCATGGTCATATTCTCGAGAATATGACCATGATTAATCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000433029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172037.3-748s21c1
Sequence:CCGGAGAGAACCATGATGGTCAATTCTCGAGAATTGACCATCATGGTTCTCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000431250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172037.3-972s21c1
Sequence:CCGGACAACCTTGGTTTGCCCTTATCTCGAGATAAGGGCAAACCAAGGTTGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000422575    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172037.3-1297s21c1
Sequence:CCGGGTATGGAATATTACTTCTATCCTCGAGGATAGAAGTAATATTCCATACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000427910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172037.3-1155s21c1
Sequence:CCGGATGAAGAGCATCCTACCATTTCTCGAGAAATGGTAGGATGCTCTTCATTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000417749    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172037.3-1550s21c1
Sequence:CCGGCATCTTCAGGTTACCATTATTCTCGAGAATAATGGTAACCTGAAGATGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???