EMAIL THIS PAGE TO A FRIEND

RDH11

retinol dehydrogenase 11 (all-trans/9-cis/11-cis)

76 Gene Product Result for
Synonyms: ARSDR1 CGI82 HCBP12 MDT1 PSDR1 RALR1 SCALD SDR7C1
Gene ID:
Human(51109) Summary: The protein encoded by this gene is an NADPH-dependent retinal reductase and a short-chain dehydrogenase/reductase. The encoded protein has no steroid dehydrogenase activity. [provided by RefSeq, Nov 2011]
Mouse(17252) retinol dehydrogenase 11
Rat(362757) retinol dehydrogenase 11 (all-trans/9-cis/11-cis)
dog(480366) retinol dehydrogenase 11 (all-trans/9-cis/11-cis)
domestic cat(101093193) retinol dehydrogenase 11 (all-trans/9-cis/11-cis)
cow(505995) retinol dehydrogenase 11 (all-trans/9-cis/11-cis)
sheep(101115127) retinol dehydrogenase 11 (all-trans/9-cis/11-cis)
naked mole-rat(101716314) retinol dehydrogenase 11 (all-trans/9-cis/11-cis)
domestic guinea pig(100718321) retinol dehydrogenase 11 (all-trans/9-cis/11-cis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301642 Anti-RDH11 affinity isolated antibody human
immunohistochemistry pricing
AV48350 Anti-RDH11 antibody produced in rabbit affinity isolated antibody human, rabbit, bovine, dog, pig, rat, horse
western blot pricing
WH0051109M1 Monoclonal Anti-RDH11 antibody produced in mouse clone 1H6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016026 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016026 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016026 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021557 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021557 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021557 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016026 Rosetta Predictions human pricing
NM_001012193 Rosetta Predictions rat pricing
XM_576057 Rosetta Predictions rat pricing
NM_021557 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348723 predicted 229
2 SASI_Hs01_00122878 predicted 469
3 SASI_Hs02_00348724 predicted 467
4 SASI_Hs01_00122880 predicted 1263
5 SASI_Hs01_00122881 predicted 919
6 SASI_Hs01_00122882 predicted 521
7 SASI_Hs02_00348725 predicted 1260
8 SASI_Hs01_00122883 predicted 1265
9 SASI_Hs01_00122884 predicted 391
10 SASI_Hs01_00122886 predicted 509
11 SASI_Hs01_00122879 predicted 572
12 SASI_Hs01_00122885 predicted 542
13 SASI_Hs01_00122887 predicted 591
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012193 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093223 predicted 729
2 SASI_Rn01_00093224 predicted 584
3 SASI_Rn02_00200412 predicted 912
4 SASI_Rn01_00093226 predicted 269
5 SASI_Rn01_00093227 predicted 558
6 SASI_Rn01_00093228 predicted 619
7 SASI_Rn01_00093229 predicted 674
8 SASI_Rn01_00093230 predicted 385
9 SASI_Rn01_00093231 predicted 358
10 SASI_Rn02_00200413 predicted 747
11 SASI_Rn01_00093225 predicted 529
12 SASI_Rn01_00093232 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00140382 predicted 906
2 SASI_Rn01_00140383 predicted 764
3 SASI_Rn01_00140384 predicted 699
4 SASI_Rn01_00140385 predicted 866
5 SASI_Rn01_00140386 predicted 864
6 SASI_Rn01_00140387 predicted 712
7 SASI_Rn01_00140388 predicted 971
8 SASI_Rn01_00140389 predicted 731
9 SASI_Rn01_00140390 predicted 793
10 SASI_Rn01_00140391 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021557 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326336 predicted 1087
2 SASI_Mm02_00326337 predicted 1171
3 SASI_Mm01_00037975 predicted 531
4 SASI_Mm02_00326338 predicted 347
5 SASI_Mm02_00326339 predicted 1177
6 SASI_Mm01_00037977 predicted 1040
7 SASI_Mm01_00037978 predicted 218
8 SASI_Mm01_00037979 predicted 895
9 SASI_Mm01_00037980 predicted 727
10 SASI_Mm02_00326340 predicted 1267
11 SASI_Mm01_00037972 predicted 1530
12 SASI_Mm01_00037973 predicted 638
13 SASI_Mm01_00037974 predicted 667
14 SASI_Mm01_00037976 predicted 590
15 SASI_Mm01_00037981 predicted 1326
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016026
VALIDATED
RDH11 MISSION shRNA Bacterial Glycerol Stock
retinol dehydrogenase 11 (all-trans/9-cis/11-cis)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016026.3-390s21c1
Sequence:CCGGCCTGTCTGATACTAAGTCTATCTCGAGATAGACTTAGTATCAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016026.3-653s21c1
Sequence:CCGGATAACCTGCAGGGCGAGAAATCTCGAGATTTCTCGCCCTGCAGGTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016026.3-1688s21c1
Sequence:CCGGCCATCCAGTCTTTATGCAAATCTCGAGATTTGCATAAAGACTGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016026.3-972s21c1
Sequence:CCGGCCAAGCTCGTAATGAGACTATCTCGAGATAGTCTCATTACGAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016026.2-922s1c1
Sequence:CCGGCCAAGCTCGTAATGAGACTATCTCGAGATAGTCTCATTACGAGCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016026.2-178s1c1
Sequence:CCGGCACAGGAGCTAATACAGGTATCTCGAGATACCTGTATTAGCTCCTGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016026.2-340s1c1
Sequence:CCGGCCTGTCTGATACTAAGTCTATCTCGAGATAGACTTAGTATCAGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027136    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016026.2-1638s1c1
Sequence:CCGGCCATCCAGTCTTTATGCAAATCTCGAGATTTGCATAAAGACTGGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016026.2-549s1c1
Sequence:CCGGCAAGGATAGTAAATGTGTCTTCTCGAGAAGACACATTTACTATCCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016026
VALIDATED
RDH11 MISSION shRNA shRNA Plasmid DNA
retinol dehydrogenase 11 (all-trans/9-cis/11-cis)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016026.3-390s21c1
Sequence:CCGGCCTGTCTGATACTAAGTCTATCTCGAGATAGACTTAGTATCAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016026.3-653s21c1
Sequence:CCGGATAACCTGCAGGGCGAGAAATCTCGAGATTTCTCGCCCTGCAGGTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016026.3-1688s21c1
Sequence:CCGGCCATCCAGTCTTTATGCAAATCTCGAGATTTGCATAAAGACTGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016026.3-972s21c1
Sequence:CCGGCCAAGCTCGTAATGAGACTATCTCGAGATAGTCTCATTACGAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016026.2-922s1c1
Sequence:CCGGCCAAGCTCGTAATGAGACTATCTCGAGATAGTCTCATTACGAGCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016026.2-178s1c1
Sequence:CCGGCACAGGAGCTAATACAGGTATCTCGAGATACCTGTATTAGCTCCTGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016026.2-340s1c1
Sequence:CCGGCCTGTCTGATACTAAGTCTATCTCGAGATAGACTTAGTATCAGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027136    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016026.2-1638s1c1
Sequence:CCGGCCATCCAGTCTTTATGCAAATCTCGAGATTTGCATAAAGACTGGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016026.2-549s1c1
Sequence:CCGGCAAGGATAGTAAATGTGTCTTCTCGAGAAGACACATTTACTATCCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016026
VALIDATED
RDH11 MISSION shRNA Lentiviral Transduction Particles
retinol dehydrogenase 11 (all-trans/9-cis/11-cis)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016026.3-390s21c1
Sequence:CCGGCCTGTCTGATACTAAGTCTATCTCGAGATAGACTTAGTATCAGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016026.3-653s21c1
Sequence:CCGGATAACCTGCAGGGCGAGAAATCTCGAGATTTCTCGCCCTGCAGGTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335941    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016026.3-1688s21c1
Sequence:CCGGCCATCCAGTCTTTATGCAAATCTCGAGATTTGCATAAAGACTGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335940    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016026.3-972s21c1
Sequence:CCGGCCAAGCTCGTAATGAGACTATCTCGAGATAGTCTCATTACGAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_016026.2-922s1c1
Sequence:CCGGCCAAGCTCGTAATGAGACTATCTCGAGATAGTCTCATTACGAGCTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016026.2-178s1c1
Sequence:CCGGCACAGGAGCTAATACAGGTATCTCGAGATACCTGTATTAGCTCCTGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016026.2-340s1c1
Sequence:CCGGCCTGTCTGATACTAAGTCTATCTCGAGATAGACTTAGTATCAGACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027136    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016026.2-1638s1c1
Sequence:CCGGCCATCCAGTCTTTATGCAAATCTCGAGATTTGCATAAAGACTGGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016026.2-549s1c1
Sequence:CCGGCAAGGATAGTAAATGTGTCTTCTCGAGAAGACACATTTACTATCCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021557
VALIDATED
RDH11 MISSION shRNA Bacterial Glycerol Stock
retinol dehydrogenase 11 (all-trans/9-cis/11-cis)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021557.5-748s21c1
Sequence:CCGGCCTCTATTATGAGATGGCTTTCTCGAGAAAGCCATCTCATAATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021557.5-382s21c1
Sequence:CCGGTGCACCTTCTCATCAACAATGCTCGAGCATTGTTGATGAGAAGGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021557.5-476s21c1
Sequence:CCGGTCACTTCCTCCTGACCCATTTCTCGAGAAATGGGTCAGGAGGAAGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021557.5-903s21c1
Sequence:CCGGCAAGGTCGCAATGAGATAATACTCGAGTATTATCTCATTGCGACCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021557.2-912s1c1
Sequence:CCGGGACGGCTTTGAGATGCACATTCTCGAGAATGTGCATCTCAAAGCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021557.2-1199s1c1
Sequence:CCGGCCATTCTGAATTGACGCGGTACTCGAGTACCGCGTCAATTCAGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021557.2-998s1c1
Sequence:CCGGCCCATCAAGGATAGTCAACTTCTCGAGAAGTTGACTATCCTTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021557.2-1222s1c1
Sequence:CCGGCCTCTATTATGAGATGGCTTTCTCGAGAAAGCCATCTCATAATAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021557.2-794s1c1
Sequence:CCGGCCTAGCTGATACCAAGTCTATCTCGAGATAGACTTGGTATCAGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021557
VALIDATED
RDH11 MISSION shRNA shRNA Plasmid DNA
retinol dehydrogenase 11 (all-trans/9-cis/11-cis)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021557.5-748s21c1
Sequence:CCGGCCTCTATTATGAGATGGCTTTCTCGAGAAAGCCATCTCATAATAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021557.5-382s21c1
Sequence:CCGGTGCACCTTCTCATCAACAATGCTCGAGCATTGTTGATGAGAAGGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021557.5-476s21c1
Sequence:CCGGTCACTTCCTCCTGACCCATTTCTCGAGAAATGGGTCAGGAGGAAGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021557.5-903s21c1
Sequence:CCGGCAAGGTCGCAATGAGATAATACTCGAGTATTATCTCATTGCGACCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021557.2-912s1c1
Sequence:CCGGGACGGCTTTGAGATGCACATTCTCGAGAATGTGCATCTCAAAGCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021557.2-1199s1c1
Sequence:CCGGCCATTCTGAATTGACGCGGTACTCGAGTACCGCGTCAATTCAGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021557.2-998s1c1
Sequence:CCGGCCCATCAAGGATAGTCAACTTCTCGAGAAGTTGACTATCCTTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021557.2-1222s1c1
Sequence:CCGGCCTCTATTATGAGATGGCTTTCTCGAGAAAGCCATCTCATAATAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021557.2-794s1c1
Sequence:CCGGCCTAGCTGATACCAAGTCTATCTCGAGATAGACTTGGTATCAGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021557
VALIDATED
RDH11 MISSION shRNA Lentiviral Transduction Particles
retinol dehydrogenase 11 (all-trans/9-cis/11-cis)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021557.5-748s21c1
Sequence:CCGGCCTCTATTATGAGATGGCTTTCTCGAGAAAGCCATCTCATAATAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294911    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021557.5-382s21c1
Sequence:CCGGTGCACCTTCTCATCAACAATGCTCGAGCATTGTTGATGAGAAGGTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021557.5-476s21c1
Sequence:CCGGTCACTTCCTCCTGACCCATTTCTCGAGAAATGGGTCAGGAGGAAGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021557.5-903s21c1
Sequence:CCGGCAAGGTCGCAATGAGATAATACTCGAGTATTATCTCATTGCGACCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021557.2-912s1c1
Sequence:CCGGGACGGCTTTGAGATGCACATTCTCGAGAATGTGCATCTCAAAGCCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021557.2-1199s1c1
Sequence:CCGGCCATTCTGAATTGACGCGGTACTCGAGTACCGCGTCAATTCAGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041780    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021557.2-998s1c1
Sequence:CCGGCCCATCAAGGATAGTCAACTTCTCGAGAAGTTGACTATCCTTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021557.2-1222s1c1
Sequence:CCGGCCTCTATTATGAGATGGCTTTCTCGAGAAAGCCATCTCATAATAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041778    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021557.2-794s1c1
Sequence:CCGGCCTAGCTGATACCAAGTCTATCTCGAGATAGACTTGGTATCAGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)