EMAIL THIS PAGE TO A FRIEND

RDH12

retinol dehydrogenase 12 (all-trans/9-cis/11-cis)

69 Gene Product Result for
Synonyms: LCA13 LCA3 RP53 SDR7C2
UniProtKB ID: Q96NR8, B2RDA2, Q8TAW6
Gene ID:
Human(145226) Summary: The protein encoded by this gene is an NADPH-dependent retinal reductase whose highest activity is toward 9-cis and all-trans-retinol. The encoded enzyme also plays a role in the metabolism of short-chain aldehydes but does not exhibit steroid dehydrogenase activity. Defects in this gene are a cause of Leber congenital amaurosis type 3 (LCA3). [provided by RefSeq, Jul 2008]
Mouse(77974) retinol dehydrogenase 12
Rat(314264) retinol dehydrogenase 12 (all-trans/9-cis/11-cis)
domestic guinea pig(100718599) retinol dehydrogenase 12 (all-trans/9-cis/11-cis)
naked mole-rat(101715642) retinol dehydrogenase 12 (all-trans/9-cis/11-cis)
cow(369021) retinol dehydrogenase 12 (all-trans/9-cis/11-cis)
sheep(101115797) retinol dehydrogenase 12 (all-trans/9-cis/11-cis)
Zebrafish(436597) retinol dehydrogenase 12 (all-trans and 9-cis)
domestic cat(101093615) retinol dehydrogenase 12 (all-trans/9-cis/11-cis)
dog(490744) retinol dehydrogenase 12 (all-trans/9-cis/11-cis)
chicken(423274) retinol dehydrogenase 12 (all-trans/9-cis/11-cis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_126957 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_126957 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_126957 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152443 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152443 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152443 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152443 Rosetta Predictions human pricing
NM_001108037 Rosetta Predictions rat pricing
NM_030017 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152443 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063896 predicted 702
2 SASI_Hs01_00063897 predicted 619
3 SASI_Hs01_00063898 predicted 558
4 SASI_Hs02_00366201 predicted 1477
5 SASI_Hs01_00063900 predicted 1304
6 SASI_Hs01_00063901 predicted 671
7 SASI_Hs01_00063902 predicted 1385
8 SASI_Hs01_00063903 predicted 615
9 SASI_Hs01_00063904 predicted 601
10 SASI_Hs01_00063905 predicted 1414
11 SASI_Hs01_00063899 predicted 1081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108037 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234735 predicted 718
2 SASI_Rn02_00234736 predicted 1205
3 SASI_Rn02_00234737 predicted 1268
4 SASI_Rn02_00234738 predicted 1247
5 SASI_Rn02_00234739 predicted 1281
6 SASI_Rn02_00234740 predicted 1111
7 SASI_Rn02_00234741 predicted 1252
8 SASI_Rn02_00234742 predicted 532
9 SASI_Rn02_00234743 predicted 1352
10 SASI_Rn02_00234744 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030017 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131569 predicted 803
2 SASI_Mm01_00131570 predicted 646
3 SASI_Mm01_00131572 predicted 816
4 SASI_Mm01_00131573 predicted 538
5 SASI_Mm02_00336387 predicted 801
6 SASI_Mm01_00131574 predicted 417
7 SASI_Mm01_00131575 predicted 445
8 SASI_Mm01_00131576 predicted 302
9 SASI_Mm01_00131577 predicted 383
10 SASI_Mm01_00131578 predicted 437
11 SASI_Mm01_00131571 predicted 567
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_126957
RDH12 MISSION shRNA Bacterial Glycerol Stock
retinol dehydrogenase 12 (all-trans/9-cis/11-cis)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126957.1-517s1c1
Sequence:CCGGCCATATTCTAAGACAACAGATCTCGAGATCTGTTGTCTTAGAATATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126957.1-181s1c1
Sequence:CCGGCCATCCATCAGGAAGTTCTTTCTCGAGAAAGAACTTCCTGATGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126957.1-867s1c1
Sequence:CCGGGCGGCTCTTCTCACCCTTCTTCTCGAGAAGAAGGGTGAGAAGAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126957.1-417s1c1
Sequence:CCGGCCTGTCTGACACCAAATCCATCTCGAGATGGATTTGGTGTCAGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126957.1-361s1c1
Sequence:CCGGGCTAGTGAAATCCGAGCAGATCTCGAGATCTGCTCGGATTTCACTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_126957
RDH12 MISSION shRNA shRNA Plasmid DNA
retinol dehydrogenase 12 (all-trans/9-cis/11-cis)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126957.1-517s1c1
Sequence:CCGGCCATATTCTAAGACAACAGATCTCGAGATCTGTTGTCTTAGAATATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126957.1-181s1c1
Sequence:CCGGCCATCCATCAGGAAGTTCTTTCTCGAGAAAGAACTTCCTGATGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126957.1-867s1c1
Sequence:CCGGGCGGCTCTTCTCACCCTTCTTCTCGAGAAGAAGGGTGAGAAGAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126957.1-417s1c1
Sequence:CCGGCCTGTCTGACACCAAATCCATCTCGAGATGGATTTGGTGTCAGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126957.1-361s1c1
Sequence:CCGGGCTAGTGAAATCCGAGCAGATCTCGAGATCTGCTCGGATTTCACTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_126957
RDH12 MISSION shRNA Lentiviral Transduction Particles
retinol dehydrogenase 12 (all-trans/9-cis/11-cis)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126957.1-517s1c1
Sequence:CCGGCCATATTCTAAGACAACAGATCTCGAGATCTGTTGTCTTAGAATATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126957.1-181s1c1
Sequence:CCGGCCATCCATCAGGAAGTTCTTTCTCGAGAAAGAACTTCCTGATGGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126957.1-867s1c1
Sequence:CCGGGCGGCTCTTCTCACCCTTCTTCTCGAGAAGAAGGGTGAGAAGAGCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126957.1-417s1c1
Sequence:CCGGCCTGTCTGACACCAAATCCATCTCGAGATGGATTTGGTGTCAGACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_126957.1-361s1c1
Sequence:CCGGGCTAGTGAAATCCGAGCAGATCTCGAGATCTGCTCGGATTTCACTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152443
RDH12 MISSION shRNA Bacterial Glycerol Stock
retinol dehydrogenase 12 (all-trans/9-cis/11-cis)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152443.1-524s1c1
Sequence:CCGGGCTCCATATTCTGATCAACAACTCGAGTTGTTGATCAGAATATGGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152443.1-473s1c1
Sequence:CCGGCACCAAATCTATCCGAGCCTTCTCGAGAAGGCTCGGATAGATTTGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152443.1-197s1c1
Sequence:CCGGCTCCTTCTTCTCGTTCCTGTACTCGAGTACAGGAACGAGAAGAAGGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152443.1-261s1c1
Sequence:CCGGTGTAGAACAAATGTGCAGCTTCTCGAGAAGCTGCACATTTGTTCTACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152443.1-409s1c1
Sequence:CCGGCCAGTGAAATCCGAGTGGATACTCGAGTATCCACTCGGATTTCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152443.2-1406s21c1
Sequence:CCGGTTGACCCTTCTGGGAATGTTTCTCGAGAAACATTCCCAGAAGGGTCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152443.2-705s21c1
Sequence:CCGGAGTAATGATGTGTCCATATTCCTCGAGGAATATGGACACATCATTACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152443
RDH12 MISSION shRNA shRNA Plasmid DNA
retinol dehydrogenase 12 (all-trans/9-cis/11-cis)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152443.1-524s1c1
Sequence:CCGGGCTCCATATTCTGATCAACAACTCGAGTTGTTGATCAGAATATGGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152443.1-473s1c1
Sequence:CCGGCACCAAATCTATCCGAGCCTTCTCGAGAAGGCTCGGATAGATTTGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152443.1-197s1c1
Sequence:CCGGCTCCTTCTTCTCGTTCCTGTACTCGAGTACAGGAACGAGAAGAAGGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152443.1-261s1c1
Sequence:CCGGTGTAGAACAAATGTGCAGCTTCTCGAGAAGCTGCACATTTGTTCTACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152443.1-409s1c1
Sequence:CCGGCCAGTGAAATCCGAGTGGATACTCGAGTATCCACTCGGATTTCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152443.2-1406s21c1
Sequence:CCGGTTGACCCTTCTGGGAATGTTTCTCGAGAAACATTCCCAGAAGGGTCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152443.2-705s21c1
Sequence:CCGGAGTAATGATGTGTCCATATTCCTCGAGGAATATGGACACATCATTACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152443
RDH12 MISSION shRNA Lentiviral Transduction Particles
retinol dehydrogenase 12 (all-trans/9-cis/11-cis)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152443.1-524s1c1
Sequence:CCGGGCTCCATATTCTGATCAACAACTCGAGTTGTTGATCAGAATATGGAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152443.1-473s1c1
Sequence:CCGGCACCAAATCTATCCGAGCCTTCTCGAGAAGGCTCGGATAGATTTGGTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152443.1-197s1c1
Sequence:CCGGCTCCTTCTTCTCGTTCCTGTACTCGAGTACAGGAACGAGAAGAAGGAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152443.1-261s1c1
Sequence:CCGGTGTAGAACAAATGTGCAGCTTCTCGAGAAGCTGCACATTTGTTCTACATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152443.1-409s1c1
Sequence:CCGGCCAGTGAAATCCGAGTGGATACTCGAGTATCCACTCGGATTTCACTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433800    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152443.2-1406s21c1
Sequence:CCGGTTGACCCTTCTGGGAATGTTTCTCGAGAAACATTCCCAGAAGGGTCAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152443.2-705s21c1
Sequence:CCGGAGTAATGATGTGTCCATATTCCTCGAGGAATATGGACACATCATTACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)