EMAIL THIS PAGE TO A FRIEND

RDH13

retinol dehydrogenase 13 (all-trans/9-cis)

39 Gene Product Result for
Synonyms: SDR7C3
UniProtKB ID: Q8NBN7, Q6UX79, Q96G88
Gene ID:
Human(112724) Summary: This gene encodes a mitochondrial short-chain dehydrogenase/reductase, which catalyzes the reduction and oxidation of retinoids. The encoded enzyme may function in retinoic acid production and may also protect the mitochondria against oxidative stress. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
Mouse(108841) retinol dehydrogenase 13 (all-trans and 9-cis)
Rat(361504) retinol dehydrogenase 13 (all-trans/9-cis)
Horse(100055280) retinol dehydrogenase 13 (all-trans/9-cis)
domestic cat(101093062) retinol dehydrogenase 13 (all-trans/9-cis)
dog(611373) retinol dehydrogenase 13 (all-trans/9-cis)
cow(508082) retinol dehydrogenase 13 (all-trans/9-cis)
sheep(101122882) retinol dehydrogenase 13 (all-trans/9-cis)
naked mole-rat(101716026) retinol dehydrogenase 13 (all-trans/9-cis)
domestic guinea pig(100715213) retinol dehydrogenase 13 (all-trans/9-cis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175372 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175372 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175372 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138412 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU019741 MISSION® esiRNA esiRNA targeting mouse Rdh13 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138412 Rosetta Predictions human pricing
NM_001108468 Rosetta Predictions rat pricing
NM_175372 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113507 predicted 676
2 SASI_Hs01_00113508 predicted 686
3 SASI_Hs01_00113509 predicted 923
4 SASI_Hs01_00113510 predicted 1096
5 SASI_Hs01_00113511 predicted 543
6 SASI_Hs01_00113512 predicted 705
7 SASI_Hs01_00113513 predicted 1205
8 SASI_Hs01_00113514 predicted 608
9 SASI_Hs01_00113515 predicted 974
10 SASI_Hs01_00113516 predicted 1107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108468 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238939 predicted 480
2 SASI_Rn02_00238940 predicted 1045
3 SASI_Rn02_00238941 predicted 591
4 SASI_Rn02_00238942 predicted 1122
5 SASI_Rn02_00238943 predicted 452
6 SASI_Rn02_00238944 predicted 1077
7 SASI_Rn02_00238945 predicted 1183
8 SASI_Rn02_00238946 predicted 237
9 SASI_Rn02_00238947 predicted 846
10 SASI_Rn02_00238948 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175372 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022277 predicted 805
2 SASI_Mm01_00022278 predicted 414
3 SASI_Mm01_00022279 predicted 1000
4 SASI_Mm01_00022280 predicted 1167
5 SASI_Mm01_00022281 predicted 443
6 SASI_Mm01_00022282 predicted 198
7 SASI_Mm02_00346186 predicted 251
8 SASI_Mm01_00022283 predicted 946
9 SASI_Mm02_00346187 predicted 845
10 SASI_Mm01_00022284 predicted 703
11 SASI_Mm01_00022276 predicted 564
12 SASI_Mm01_00022285 predicted 912
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175372
VALIDATED
RDH13 MISSION shRNA Bacterial Glycerol Stock
retinol dehydrogenase 13 (all-trans/9-cis)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175372.3-446s21c1
Sequence:CCGGGCGAGTAGACATTCTGGTCAACTCGAGTTGACCAGAATGTCTACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175372.3-244s21c1
Sequence:CCGGGCATCGGGAAACAAACTGCTTCTCGAGAAGCAGTTTGTTTCCCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175372.3-638s21c1
Sequence:CCGGGCACATAGACTTCGAGGACTTCTCGAGAAGTCCTCGAAGTCTATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175372.3-927s21c1
Sequence:CCGGGCAGAAGAACTGGAGAATGTTCTCGAGAACATTCTCCAGTTCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175372.3-1311s21c1
Sequence:CCGGCAATGTTAGTTCTAGCATTTACTCGAGTAAATGCTAGAACTAACATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175372.2-285s1c1
Sequence:CCGGGCATCGGGAAACAAACTGCTTCTCGAGAAGCAGTTTGTTTCCCGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175372.2-1056s1c1
Sequence:CCGGCCCGCAGACTTTGGACGGAAACTCGAGTTTCCGTCCAAAGTCTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175372.2-968s1c1
Sequence:CCGGGCAGAAGAACTGGAGAATGTTCTCGAGAACATTCTCCAGTTCTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175372.2-487s1c1
Sequence:CCGGGCGAGTAGACATTCTGGTCAACTCGAGTTGACCAGAATGTCTACTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175372.2-679s1c1
Sequence:CCGGGCACATAGACTTCGAGGACTTCTCGAGAAGTCCTCGAAGTCTATGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175372
VALIDATED
RDH13 MISSION shRNA shRNA Plasmid DNA
retinol dehydrogenase 13 (all-trans/9-cis)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175372.3-446s21c1
Sequence:CCGGGCGAGTAGACATTCTGGTCAACTCGAGTTGACCAGAATGTCTACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175372.3-244s21c1
Sequence:CCGGGCATCGGGAAACAAACTGCTTCTCGAGAAGCAGTTTGTTTCCCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175372.3-638s21c1
Sequence:CCGGGCACATAGACTTCGAGGACTTCTCGAGAAGTCCTCGAAGTCTATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175372.3-927s21c1
Sequence:CCGGGCAGAAGAACTGGAGAATGTTCTCGAGAACATTCTCCAGTTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175372.3-1311s21c1
Sequence:CCGGCAATGTTAGTTCTAGCATTTACTCGAGTAAATGCTAGAACTAACATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175372.2-285s1c1
Sequence:CCGGGCATCGGGAAACAAACTGCTTCTCGAGAAGCAGTTTGTTTCCCGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175372.2-1056s1c1
Sequence:CCGGCCCGCAGACTTTGGACGGAAACTCGAGTTTCCGTCCAAAGTCTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175372.2-968s1c1
Sequence:CCGGGCAGAAGAACTGGAGAATGTTCTCGAGAACATTCTCCAGTTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175372.2-487s1c1
Sequence:CCGGGCGAGTAGACATTCTGGTCAACTCGAGTTGACCAGAATGTCTACTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175372.2-679s1c1
Sequence:CCGGGCACATAGACTTCGAGGACTTCTCGAGAAGTCCTCGAAGTCTATGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175372
VALIDATED
RDH13 MISSION shRNA Lentiviral Transduction Particles
retinol dehydrogenase 13 (all-trans/9-cis)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175372.3-446s21c1
Sequence:CCGGGCGAGTAGACATTCTGGTCAACTCGAGTTGACCAGAATGTCTACTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175372.3-244s21c1
Sequence:CCGGGCATCGGGAAACAAACTGCTTCTCGAGAAGCAGTTTGTTTCCCGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175372.3-638s21c1
Sequence:CCGGGCACATAGACTTCGAGGACTTCTCGAGAAGTCCTCGAAGTCTATGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175372.3-927s21c1
Sequence:CCGGGCAGAAGAACTGGAGAATGTTCTCGAGAACATTCTCCAGTTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175372.3-1311s21c1
Sequence:CCGGCAATGTTAGTTCTAGCATTTACTCGAGTAAATGCTAGAACTAACATTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175372.2-285s1c1
Sequence:CCGGGCATCGGGAAACAAACTGCTTCTCGAGAAGCAGTTTGTTTCCCGATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175372.2-1056s1c1
Sequence:CCGGCCCGCAGACTTTGGACGGAAACTCGAGTTTCCGTCCAAAGTCTGCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175372.2-968s1c1
Sequence:CCGGGCAGAAGAACTGGAGAATGTTCTCGAGAACATTCTCCAGTTCTTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175372.2-487s1c1
Sequence:CCGGGCGAGTAGACATTCTGGTCAACTCGAGTTGACCAGAATGTCTACTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175372.2-679s1c1
Sequence:CCGGGCACATAGACTTCGAGGACTTCTCGAGAAGTCCTCGAAGTCTATGTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138412
VALIDATED
RDH13 MISSION shRNA Bacterial Glycerol Stock
retinol dehydrogenase 13 (all-trans/9-cis)
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_138412.2-831s1c1
Sequence:CCGGGACGAGGAAGTATAACACCAACTCGAGTTGGTGTTATACTTCCTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138412.2-1504s1c1
Sequence:CCGGCTGGGAATCTAAACTGGGAATCTCGAGATTCCCAGTTTAGATTCCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-1108s1c1
Sequence:CCGGGTTTCCGGAAAGTACTTCGATCTCGAGATCGAAGTACTTTCCGGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-1115s1c1
Sequence:CCGGGAAAGTACTTCGATGGACTCACTCGAGTGAGTCCATCGAAGTACTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_138412.2-1707s1c1
Sequence:CCGGGCAGTGAGATGCTCAGAATAACTCGAGTTATTCTGAGCATCTCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_138412.2-577s1c1
Sequence:CCGGGAGTTTGCAGCAAAGATCATTCTCGAGAATGATCTTTGCTGCAAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-840s1c1
Sequence:CCGGGTATAACACCAAAGCCGCCTACTCGAGTAGGCGGCTTTGGTGTTATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-561s1c1
Sequence:CCGGCCTCAAGTCTATCCGAGAGTTCTCGAGAACTCTCGGATAGACTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-825s1c1
Sequence:CCGGCTGGCAGACGAGGAAGTATAACTCGAGTTATACTTCCTCGTCTGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138412.2-1693s1c1
Sequence:CCGGCCTTGGTTTCTTCAGCAGTGACTCGAGTCACTGCTGAAGAAACCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138412.2-1705s1c1
Sequence:CCGGCAGCAGTGAGATGCTCAGAATCTCGAGATTCTGAGCATCTCACTGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-810s1c1
Sequence:CCGGCTTTGACGACTTGAACTGGCACTCGAGTGCCAGTTCAAGTCGTCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138412.2-1503s1c1
Sequence:CCGGCCTGGGAATCTAAACTGGGAACTCGAGTTCCCAGTTTAGATTCCCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-801s1c1
Sequence:CCGGGCACATAGACTTTGACGACTTCTCGAGAAGTCGTCAAAGTCTATGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-678s1c1
Sequence:CCGGCGAGATGCAGTTTGGCGTTAACTCGAGTTAACGCCAAACTGCATCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000026574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-609s1c1
Sequence:CCGGGCGAGTGGACATTCTAATCAACTCGAGTTGATTAGAATGTCCACTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-613s1c1
Sequence:CCGGGTGGACATTCTAATCAACAACCTCGAGGTTGTTGATTAGAATGTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138412
VALIDATED
RDH13 MISSION shRNA shRNA Plasmid DNA
retinol dehydrogenase 13 (all-trans/9-cis)
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_138412.2-831s1c1
Sequence:CCGGGACGAGGAAGTATAACACCAACTCGAGTTGGTGTTATACTTCCTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138412.2-1504s1c1
Sequence:CCGGCTGGGAATCTAAACTGGGAATCTCGAGATTCCCAGTTTAGATTCCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-1108s1c1
Sequence:CCGGGTTTCCGGAAAGTACTTCGATCTCGAGATCGAAGTACTTTCCGGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-1115s1c1
Sequence:CCGGGAAAGTACTTCGATGGACTCACTCGAGTGAGTCCATCGAAGTACTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_138412.2-1707s1c1
Sequence:CCGGGCAGTGAGATGCTCAGAATAACTCGAGTTATTCTGAGCATCTCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_138412.2-577s1c1
Sequence:CCGGGAGTTTGCAGCAAAGATCATTCTCGAGAATGATCTTTGCTGCAAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-840s1c1
Sequence:CCGGGTATAACACCAAAGCCGCCTACTCGAGTAGGCGGCTTTGGTGTTATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-561s1c1
Sequence:CCGGCCTCAAGTCTATCCGAGAGTTCTCGAGAACTCTCGGATAGACTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-825s1c1
Sequence:CCGGCTGGCAGACGAGGAAGTATAACTCGAGTTATACTTCCTCGTCTGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138412.2-1693s1c1
Sequence:CCGGCCTTGGTTTCTTCAGCAGTGACTCGAGTCACTGCTGAAGAAACCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138412.2-1705s1c1
Sequence:CCGGCAGCAGTGAGATGCTCAGAATCTCGAGATTCTGAGCATCTCACTGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-810s1c1
Sequence:CCGGCTTTGACGACTTGAACTGGCACTCGAGTGCCAGTTCAAGTCGTCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138412.2-1503s1c1
Sequence:CCGGCCTGGGAATCTAAACTGGGAACTCGAGTTCCCAGTTTAGATTCCCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-801s1c1
Sequence:CCGGGCACATAGACTTTGACGACTTCTCGAGAAGTCGTCAAAGTCTATGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-678s1c1
Sequence:CCGGCGAGATGCAGTTTGGCGTTAACTCGAGTTAACGCCAAACTGCATCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-609s1c1
Sequence:CCGGGCGAGTGGACATTCTAATCAACTCGAGTTGATTAGAATGTCCACTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-613s1c1
Sequence:CCGGGTGGACATTCTAATCAACAACCTCGAGGTTGTTGATTAGAATGTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138412
VALIDATED
RDH13 MISSION shRNA Lentiviral Transduction Particles
retinol dehydrogenase 13 (all-trans/9-cis)
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_138412.2-831s1c1
Sequence:CCGGGACGAGGAAGTATAACACCAACTCGAGTTGGTGTTATACTTCCTCGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141447    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138412.2-1504s1c1
Sequence:CCGGCTGGGAATCTAAACTGGGAATCTCGAGATTCCCAGTTTAGATTCCCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-1108s1c1
Sequence:CCGGGTTTCCGGAAAGTACTTCGATCTCGAGATCGAAGTACTTTCCGGAAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-1115s1c1
Sequence:CCGGGAAAGTACTTCGATGGACTCACTCGAGTGAGTCCATCGAAGTACTTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142523    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_138412.2-1707s1c1
Sequence:CCGGGCAGTGAGATGCTCAGAATAACTCGAGTTATTCTGAGCATCTCACTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_138412.2-577s1c1
Sequence:CCGGGAGTTTGCAGCAAAGATCATTCTCGAGAATGATCTTTGCTGCAAACTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-840s1c1
Sequence:CCGGGTATAACACCAAAGCCGCCTACTCGAGTAGGCGGCTTTGGTGTTATACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-561s1c1
Sequence:CCGGCCTCAAGTCTATCCGAGAGTTCTCGAGAACTCTCGGATAGACTTGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-825s1c1
Sequence:CCGGCTGGCAGACGAGGAAGTATAACTCGAGTTATACTTCCTCGTCTGCCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139588    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138412.2-1693s1c1
Sequence:CCGGCCTTGGTTTCTTCAGCAGTGACTCGAGTCACTGCTGAAGAAACCAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138412.2-1705s1c1
Sequence:CCGGCAGCAGTGAGATGCTCAGAATCTCGAGATTCTGAGCATCTCACTGCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-810s1c1
Sequence:CCGGCTTTGACGACTTGAACTGGCACTCGAGTGCCAGTTCAAGTCGTCAAAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026569    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138412.2-1503s1c1
Sequence:CCGGCCTGGGAATCTAAACTGGGAACTCGAGTTCCCAGTTTAGATTCCCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-801s1c1
Sequence:CCGGGCACATAGACTTTGACGACTTCTCGAGAAGTCGTCAAAGTCTATGTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026558    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-678s1c1
Sequence:CCGGCGAGATGCAGTTTGGCGTTAACTCGAGTTAACGCCAAACTGCATCTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000026574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-609s1c1
Sequence:CCGGGCGAGTGGACATTCTAATCAACTCGAGTTGATTAGAATGTCCACTCGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138412.2-613s1c1
Sequence:CCGGGTGGACATTCTAATCAACAACCTCGAGGTTGTTGATTAGAATGTCCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)