EMAIL THIS PAGE TO A FRIEND

RDH16

retinol dehydrogenase 16 (all-trans)

44 Gene Product Result for
Synonyms: RODH-4 SDR9C8
UniProtKB ID: O75452, Q9UNV2
Gene ID:
Mouse(19683) retinol dehydrogenase 16
Rat(299511) retinol dehydrogenase 16 (all-trans)
domestic cat(101088854) retinol dehydrogenase 16 (all-trans)
dog(474409) retinol dehydrogenase 16 (all-trans)
cow(519940) retinol dehydrogenase 16 (all-trans)
sheep(101121928) retinol dehydrogenase 16 (all-trans)
domestic guinea pig(100729007) retinol dehydrogenase 16 (all-trans)
naked mole-rat(101698175) retinol dehydrogenase 16 (all-trans)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009040 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009040 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009040 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003708 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003708 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003708 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003708 Rosetta Predictions human pricing
NM_199208 Rosetta Predictions rat pricing
NM_009040 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336124 predicted 1300
2 SASI_Hs01_00028175 predicted 814
3 SASI_Hs02_00336125 predicted 1327
4 SASI_Hs01_00028176 predicted 1076
5 SASI_Hs02_00336126 predicted 1171
6 SASI_Hs01_00028177 predicted 885
7 SASI_Hs01_00028178 predicted 805
8 SASI_Hs01_00028180 predicted 1112
9 SASI_Hs01_00028181 predicted 810
10 SASI_Hs02_00336127 predicted 1173
11 SASI_Hs01_00028179 predicted 1453
12 SASI_Hs01_00028182 predicted 933
13 SASI_Hs01_00028183 predicted 1213
14 SASI_Hs01_00028184 predicted 2054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036683 predicted 581
2 SASI_Rn01_00036684 predicted 868
3 SASI_Rn01_00036685 predicted 897
4 SASI_Rn01_00036686 predicted 654
5 SASI_Rn01_00036687 predicted 939
6 SASI_Rn01_00036692 predicted 944
7 SASI_Rn01_00036688 predicted 824
8 SASI_Rn01_00036690 predicted 1002
9 SASI_Rn02_00270150 predicted 1177
10 SASI_Rn02_00270151 predicted 871
11 SASI_Rn01_00036689 predicted 590
12 SASI_Rn01_00036691 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009040 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187368 predicted 1109
2 SASI_Mm01_00187369 predicted 1114
3 SASI_Mm01_00187370 predicted 1116
4 SASI_Mm01_00187371 predicted 1278
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009040
RDH16 MISSION shRNA Bacterial Glycerol Stock
retinol dehydrogenase 16 (all-trans)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009040.3-638s21c1
Sequence:CCGGGGGTGAAGGTGGCTATTATAGCTCGAGCTATAATAGCCACCTTCACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425232    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009040.3-1111s21c1
Sequence:CCGGCAATACACTTCATCTTGTTAACTCGAGTTAACAAGATGAAGTGTATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009040.3-1351s21c1
Sequence:CCGGCCTATGCAAGATGGAATTATCCTCGAGGATAATTCCATCTTGCATAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009040.3-1400s21c1
Sequence:CCGGTACTAGGTCTGAGGGAGTTACCTCGAGGTAACTCCCTCAGACCTAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009040.1-540s1c1
Sequence:CCGGATGGGTCGAGTGTCTCTCTTTCTCGAGAAAGAGAGACACTCGACCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009040.1-114s1c1
Sequence:CCGGGTGAGCCATCTCCAAGACAAACTCGAGTTTGTCTTGGAGATGGCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009040.1-2144s1c1
Sequence:CCGGCGCAGGAGAAACTTGTAAATACTCGAGTATTTACAAGTTTCTCCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009040.1-125s1c1
Sequence:CCGGCCAAGACAAATATGTCTTCATCTCGAGATGAAGACATATTTGTCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009040.1-734s1c1
Sequence:CCGGCAGCTCAGAAATCAGGGAGATCTCGAGATCTCCCTGATTTCTGAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009040.1-2144s1c2
Sequence:CCGGCGCAGGAGAAACTTGTAAATACTCGAGTATTTACAAGTTTCTCCTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009040
RDH16 MISSION shRNA shRNA Plasmid DNA
retinol dehydrogenase 16 (all-trans)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009040.3-638s21c1
Sequence:CCGGGGGTGAAGGTGGCTATTATAGCTCGAGCTATAATAGCCACCTTCACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425232    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009040.3-1111s21c1
Sequence:CCGGCAATACACTTCATCTTGTTAACTCGAGTTAACAAGATGAAGTGTATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009040.3-1351s21c1
Sequence:CCGGCCTATGCAAGATGGAATTATCCTCGAGGATAATTCCATCTTGCATAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009040.3-1400s21c1
Sequence:CCGGTACTAGGTCTGAGGGAGTTACCTCGAGGTAACTCCCTCAGACCTAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009040.1-540s1c1
Sequence:CCGGATGGGTCGAGTGTCTCTCTTTCTCGAGAAAGAGAGACACTCGACCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009040.1-114s1c1
Sequence:CCGGGTGAGCCATCTCCAAGACAAACTCGAGTTTGTCTTGGAGATGGCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009040.1-2144s1c1
Sequence:CCGGCGCAGGAGAAACTTGTAAATACTCGAGTATTTACAAGTTTCTCCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009040.1-125s1c1
Sequence:CCGGCCAAGACAAATATGTCTTCATCTCGAGATGAAGACATATTTGTCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009040.1-734s1c1
Sequence:CCGGCAGCTCAGAAATCAGGGAGATCTCGAGATCTCCCTGATTTCTGAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009040.1-2144s1c2
Sequence:CCGGCGCAGGAGAAACTTGTAAATACTCGAGTATTTACAAGTTTCTCCTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009040
RDH16 MISSION shRNA Lentiviral Transduction Particles
retinol dehydrogenase 16 (all-trans)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009040.3-638s21c1
Sequence:CCGGGGGTGAAGGTGGCTATTATAGCTCGAGCTATAATAGCCACCTTCACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425232    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009040.3-1111s21c1
Sequence:CCGGCAATACACTTCATCTTGTTAACTCGAGTTAACAAGATGAAGTGTATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009040.3-1351s21c1
Sequence:CCGGCCTATGCAAGATGGAATTATCCTCGAGGATAATTCCATCTTGCATAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437472    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009040.3-1400s21c1
Sequence:CCGGTACTAGGTCTGAGGGAGTTACCTCGAGGTAACTCCCTCAGACCTAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009040.1-540s1c1
Sequence:CCGGATGGGTCGAGTGTCTCTCTTTCTCGAGAAAGAGAGACACTCGACCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009040.1-114s1c1
Sequence:CCGGGTGAGCCATCTCCAAGACAAACTCGAGTTTGTCTTGGAGATGGCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041943    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009040.1-2144s1c1
Sequence:CCGGCGCAGGAGAAACTTGTAAATACTCGAGTATTTACAAGTTTCTCCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009040.1-125s1c1
Sequence:CCGGCCAAGACAAATATGTCTTCATCTCGAGATGAAGACATATTTGTCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009040.1-734s1c1
Sequence:CCGGCAGCTCAGAAATCAGGGAGATCTCGAGATCTCCCTGATTTCTGAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174061    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009040.1-2144s1c2
Sequence:CCGGCGCAGGAGAAACTTGTAAATACTCGAGTATTTACAAGTTTCTCCTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003708
RDH16 MISSION shRNA Bacterial Glycerol Stock
retinol dehydrogenase 16 (all-trans)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003708.3-1268s21c1
Sequence:CCGCTGATTCTCCTGGGAGATAATTCTCGAGAATTATCTCCCAGGAGAATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003708.3-1183s21c1
Sequence:CCGGATCCTTGGGAGAGATATAAAGCTCGAGCTTTATATCTCTCCCAAGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003708.2-1599s1c1
Sequence:CCGGAGCTGAACAAATGGAGCAGAACTCGAGTTCTGCTCCATTTGTTCAGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003708.2-1569s1c1
Sequence:CCGGCGAGAAGTTTGTTGCAGACTACTCGAGTAGTCTGCAACAAACTTCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003708.2-930s1c1
Sequence:CCGGCCTGAGAGATAAGTATGTGTTCTCGAGAACACATACTTATCTCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003708.2-1752s1c1
Sequence:CCGGCCTGGTGGATGCCATTATGTACTCGAGTACATAATGGCATCCACCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003708.2-1457s1c1
Sequence:CCGGCTATGATTGAACCTGGCTATTCTCGAGAATAGCCAGGTTCAATCATAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003708
RDH16 MISSION shRNA shRNA Plasmid DNA
retinol dehydrogenase 16 (all-trans)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003708.3-1268s21c1
Sequence:CCGCTGATTCTCCTGGGAGATAATTCTCGAGAATTATCTCCCAGGAGAATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003708.3-1183s21c1
Sequence:CCGGATCCTTGGGAGAGATATAAAGCTCGAGCTTTATATCTCTCCCAAGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003708.2-1599s1c1
Sequence:CCGGAGCTGAACAAATGGAGCAGAACTCGAGTTCTGCTCCATTTGTTCAGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003708.2-1569s1c1
Sequence:CCGGCGAGAAGTTTGTTGCAGACTACTCGAGTAGTCTGCAACAAACTTCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003708.2-930s1c1
Sequence:CCGGCCTGAGAGATAAGTATGTGTTCTCGAGAACACATACTTATCTCTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003708.2-1752s1c1
Sequence:CCGGCCTGGTGGATGCCATTATGTACTCGAGTACATAATGGCATCCACCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000027277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003708.2-1457s1c1
Sequence:CCGGCTATGATTGAACCTGGCTATTCTCGAGAATAGCCAGGTTCAATCATAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003708
RDH16 MISSION shRNA Lentiviral Transduction Particles
retinol dehydrogenase 16 (all-trans)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003708.3-1268s21c1
Sequence:CCGCTGATTCTCCTGGGAGATAATTCTCGAGAATTATCTCCCAGGAGAATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431684    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003708.3-1183s21c1
Sequence:CCGGATCCTTGGGAGAGATATAAAGCTCGAGCTTTATATCTCTCCCAAGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003708.2-1599s1c1
Sequence:CCGGAGCTGAACAAATGGAGCAGAACTCGAGTTCTGCTCCATTTGTTCAGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003708.2-1569s1c1
Sequence:CCGGCGAGAAGTTTGTTGCAGACTACTCGAGTAGTCTGCAACAAACTTCTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003708.2-930s1c1
Sequence:CCGGCCTGAGAGATAAGTATGTGTTCTCGAGAACACATACTTATCTCTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003708.2-1752s1c1
Sequence:CCGGCCTGGTGGATGCCATTATGTACTCGAGTACATAATGGCATCCACCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000027277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003708.2-1457s1c1
Sequence:CCGGCTATGATTGAACCTGGCTATTCTCGAGAATAGCCAGGTTCAATCATAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)