EMAIL THIS PAGE TO A FRIEND

RDH5

retinol dehydrogenase 5 (11-cis/9-cis)

48 Gene Product Result for
Synonyms: 9cRDH HSD17B9 RDH1 SDR9C5
UniProtKB ID: Q92781, O00179, Q8TAI2
Gene ID:
Human(5959) Summary: This gene encodes an enzyme belonging to the short-chain dehydrogenases/reductases (SDR) family. This retinol dehydrogenase functions to catalyze the final step in the biosynthesis of 11-cis retinaldehyde, which is the universal chromophore of visual pigments. Mutations in this gene cause autosomal recessive fundus albipunctatus, a rare form of night blindness that is characterized by a delay in the regeneration of cone and rod photopigments. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring upstream BLOC1S1 (biogenesis of lysosomal organelles complex-1, subunit 1) gene. [provided by RefSeq, Dec 2010]
Mouse(19682) retinol dehydrogenase 5
Rat(366791) retinol dehydrogenase 5 (11-cis/9-cis)
Zebrafish(556528) retinol dehydrogenase 5 (11-cis/9-cis)
domestic cat(101090450) retinol dehydrogenase 5 (11-cis/9-cis)
dog(481099) retinol dehydrogenase 5 (11-cis/9-cis)
chicken(395452) retinol dehydrogenase 5 (11-cis/9-cis)
chicken(424169) retinol dehydrogenase 5 (11-cis/9-cis)
cow(281448) retinol dehydrogenase 5 (11-cis/9-cis)
sheep(101115199) retinol dehydrogenase 5 (11-cis/9-cis)
naked mole-rat(101701578) retinol dehydrogenase 5 (11-cis/9-cis)
domestic guinea pig(100716482) retinol dehydrogenase 5 (11-cis/9-cis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134006 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134006 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134006 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002905 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002905 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002905 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002905 Rosetta Predictions human pricing
XM_345770 Rosetta Predictions rat pricing
NM_134006 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002905 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139333 predicted 332
2 SASI_Hs01_00139334 predicted 626
3 SASI_Hs01_00139335 predicted 873
4 SASI_Hs01_00139337 predicted 348
5 SASI_Hs01_00139338 predicted 493
6 SASI_Hs01_00139339 predicted 380
7 SASI_Hs01_00139340 predicted 505
8 SASI_Hs02_00334717 predicted 400
9 SASI_Hs01_00139341 predicted 715
10 SASI_Hs01_00139342 predicted 344
11 SASI_Hs01_00139336 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00398678 predicted 661
2 SASI_Rn02_00398679 predicted 651
3 SASI_Rn02_00398680 predicted 661
4 SASI_Rn02_00398681 predicted 670
5 SASI_Rn02_00398682 predicted 668
6 SASI_Rn02_00398683 predicted 645
7 SASI_Rn02_00398684 predicted 678
8 SASI_Rn02_00398685 predicted 702
9 SASI_Rn02_00398686 predicted 699
10 SASI_Rn02_00398687 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134006 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188769 predicted 777
2 SASI_Mm02_00339148 predicted 565
3 SASI_Mm01_00188770 predicted 889
4 SASI_Mm01_00188771 predicted 554
5 SASI_Mm01_00188772 predicted 666
6 SASI_Mm01_00188773 predicted 472
7 SASI_Mm01_00188774 predicted 899
8 SASI_Mm01_00188775 predicted 256
9 SASI_Mm01_00188777 predicted 745
10 SASI_Mm01_00188778 predicted 767
11 SASI_Mm01_00188776 predicted 851
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134006
RDH5 MISSION shRNA Bacterial Glycerol Stock
retinol dehydrogenase 5 (11-cis/9-cis)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134006.3-385s1c1
Sequence:CCGGCCACACAACACTACTGGATATCTCGAGATATCCAGTAGTGTTGTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134006.3-544s1c1
Sequence:CCGGCCAGAGAGTACTGAGTGTGAACTCGAGTTCACACTCAGTACTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134006.3-920s1c1
Sequence:CCGGCTGATCTGTGACCCAGAACTACTCGAGTAGTTCTGGGTCACAGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134006.3-875s1c1
Sequence:CCGGGCCTTCCTCGATACTTATCTTCTCGAGAAGATAAGTATCGAGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134006.3-235s1c1
Sequence:CCGGCAGTGATGCTTTCATCTTCATCTCGAGATGAAGATGAAAGCATCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134006
RDH5 MISSION shRNA shRNA Plasmid DNA
retinol dehydrogenase 5 (11-cis/9-cis)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134006.3-385s1c1
Sequence:CCGGCCACACAACACTACTGGATATCTCGAGATATCCAGTAGTGTTGTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134006.3-544s1c1
Sequence:CCGGCCAGAGAGTACTGAGTGTGAACTCGAGTTCACACTCAGTACTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134006.3-920s1c1
Sequence:CCGGCTGATCTGTGACCCAGAACTACTCGAGTAGTTCTGGGTCACAGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134006.3-875s1c1
Sequence:CCGGGCCTTCCTCGATACTTATCTTCTCGAGAAGATAAGTATCGAGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000041942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134006.3-235s1c1
Sequence:CCGGCAGTGATGCTTTCATCTTCATCTCGAGATGAAGATGAAAGCATCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134006
RDH5 MISSION shRNA Lentiviral Transduction Particles
retinol dehydrogenase 5 (11-cis/9-cis)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134006.3-385s1c1
Sequence:CCGGCCACACAACACTACTGGATATCTCGAGATATCCAGTAGTGTTGTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134006.3-544s1c1
Sequence:CCGGCCAGAGAGTACTGAGTGTGAACTCGAGTTCACACTCAGTACTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134006.3-920s1c1
Sequence:CCGGCTGATCTGTGACCCAGAACTACTCGAGTAGTTCTGGGTCACAGATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134006.3-875s1c1
Sequence:CCGGGCCTTCCTCGATACTTATCTTCTCGAGAAGATAAGTATCGAGGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000041942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134006.3-235s1c1
Sequence:CCGGCAGTGATGCTTTCATCTTCATCTCGAGATGAAGATGAAAGCATCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002905
RDH5 MISSION shRNA Bacterial Glycerol Stock
retinol dehydrogenase 5 (11-cis/9-cis)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002905.1-515s1c1
Sequence:CCGGTGTGAACACAATGGGTCCCATCTCGAGATGGGACCCATTGTGTTCACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002905.1-409s1c1
Sequence:CCGGACGTTAAGGAAGCAGGGCTTTCTCGAGAAAGCCCTGCTTCCTTAACGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002905.1-193s1c1
Sequence:CCGGGCAATGCCTTTGTCTTCATCACTCGAGTGATGAAGACAAAGGCATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002905.1-752s1c1
Sequence:CCGGCAACTTGGAGAGTCTGGAGAACTCGAGTTCTCCAGACTCTCCAAGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002905.1-348s1c1
Sequence:CCGGACCCTGTTGGATATCACTGATCTCGAGATCAGTGATATCCAACAGGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002905.3-750s21c1
Sequence:CCGGGAGGCGGGATGTAGCTCATTTCTCGAGAAATGAGCTACATCCCGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002905.3-1173s21c1
Sequence:CCGGGGACAAGGACTTTGATTTATTCTCGAGAATAAATCAAAGTCCTTGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002905.3-947s21c1
Sequence:CCGGTGATCTGTGACCCGGACCTAACTCGAGTTAGGTCCGGGTCACAGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002905
RDH5 MISSION shRNA shRNA Plasmid DNA
retinol dehydrogenase 5 (11-cis/9-cis)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002905.1-515s1c1
Sequence:CCGGTGTGAACACAATGGGTCCCATCTCGAGATGGGACCCATTGTGTTCACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002905.1-409s1c1
Sequence:CCGGACGTTAAGGAAGCAGGGCTTTCTCGAGAAAGCCCTGCTTCCTTAACGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002905.1-193s1c1
Sequence:CCGGGCAATGCCTTTGTCTTCATCACTCGAGTGATGAAGACAAAGGCATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002905.1-752s1c1
Sequence:CCGGCAACTTGGAGAGTCTGGAGAACTCGAGTTCTCCAGACTCTCCAAGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002905.1-348s1c1
Sequence:CCGGACCCTGTTGGATATCACTGATCTCGAGATCAGTGATATCCAACAGGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002905.3-750s21c1
Sequence:CCGGGAGGCGGGATGTAGCTCATTTCTCGAGAAATGAGCTACATCCCGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002905.3-1173s21c1
Sequence:CCGGGGACAAGGACTTTGATTTATTCTCGAGAATAAATCAAAGTCCTTGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002905.3-947s21c1
Sequence:CCGGTGATCTGTGACCCGGACCTAACTCGAGTTAGGTCCGGGTCACAGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002905
RDH5 MISSION shRNA Lentiviral Transduction Particles
retinol dehydrogenase 5 (11-cis/9-cis)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028659    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002905.1-515s1c1
Sequence:CCGGTGTGAACACAATGGGTCCCATCTCGAGATGGGACCCATTGTGTTCACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028637    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002905.1-409s1c1
Sequence:CCGGACGTTAAGGAAGCAGGGCTTTCTCGAGAAAGCCCTGCTTCCTTAACGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002905.1-193s1c1
Sequence:CCGGGCAATGCCTTTGTCTTCATCACTCGAGTGATGAAGACAAAGGCATTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002905.1-752s1c1
Sequence:CCGGCAACTTGGAGAGTCTGGAGAACTCGAGTTCTCCAGACTCTCCAAGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002905.1-348s1c1
Sequence:CCGGACCCTGTTGGATATCACTGATCTCGAGATCAGTGATATCCAACAGGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002905.3-750s21c1
Sequence:CCGGGAGGCGGGATGTAGCTCATTTCTCGAGAAATGAGCTACATCCCGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424375    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002905.3-1173s21c1
Sequence:CCGGGGACAAGGACTTTGATTTATTCTCGAGAATAAATCAAAGTCCTTGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002905.3-947s21c1
Sequence:CCGGTGATCTGTGACCCGGACCTAACTCGAGTTAGGTCCGGGTCACAGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)