EMAIL THIS PAGE TO A FRIEND

RDM1

RAD52 motif 1

64 Gene Product Result for
Synonyms: RAD52B
Gene ID:
Human(201299) Summary: This gene encodes a protein involved in the cellular response to cisplatin, a drug commonly used in chemotherapy. The protein encoded by this gene contains two motifs: a motif found in RAD52, a protein that functions in DNA double-strand breaks and homologous recombination, and an RNA recognition motif (RRM) that is not found in RAD52. The RAD52 motif region in RAD52 is important for protein function and may be involved in DNA binding or oligomerization. Alternatively spliced transcript variants encoding different isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(66599) RAD52 motif 1
Rat(287726) RAD52 motif 1
Thale Cress(821839) RNA-directed DNA methylation 1 protein
chicken(395228) RAD52 motif 1
dog(480794) RAD52 motif 1
sheep(101119320) RAD52 motif 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145654 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145654 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145654 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025654 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025654 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025654 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034836 Rosetta Predictions human pricing
NM_145654 Rosetta Predictions human pricing
NM_001105842 Rosetta Predictions rat pricing
NM_025654 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034836 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121096 predicted 401
2 SASI_Hs02_00308141 predicted 412
3 SASI_Hs01_00121099 predicted 217
4 SASI_Hs01_00121100 predicted 323
5 SASI_Hs01_00121101 predicted 400
6 SASI_Hs01_00121102 predicted 319
7 SASI_Hs01_00121103 predicted 388
8 SASI_Hs01_00121104 predicted 485
9 SASI_Hs02_00308142 predicted 450
10 SASI_Hs01_00121105 predicted 390
11 SASI_Hs01_00121097 predicted 457
12 SASI_Hs01_00121098 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145654 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193762 predicted 396
2 SASI_Hs02_00365278 predicted 408
3 SASI_Hs01_00193765 predicted 217
4 SASI_Hs01_00193766 predicted 324
5 SASI_Hs01_00193767 predicted 398
6 SASI_Hs01_00193768 predicted 318
7 SASI_Hs01_00193769 predicted 384
8 SASI_Hs01_00193770 predicted 481
9 SASI_Hs02_00365279 predicted 454
10 SASI_Hs01_00193771 predicted 385
11 SASI_Hs01_00193763 predicted 449
12 SASI_Hs01_00193764 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105842 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213062 predicted 211
2 SASI_Rn02_00213063 predicted 594
3 SASI_Rn02_00213064 predicted 798
4 SASI_Rn02_00213065 predicted 401
5 SASI_Rn02_00213066 predicted 378
6 SASI_Rn02_00213067 predicted 317
7 SASI_Rn02_00213068 predicted 336
8 SASI_Rn02_00213069 predicted 302
9 SASI_Rn02_00213070 predicted 725
10 SASI_Rn02_00213071 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106182 predicted 621
2 SASI_Mm01_00106183 predicted 676
3 SASI_Mm01_00106184 predicted 758
4 SASI_Mm01_00106185 predicted 249
5 SASI_Mm01_00106187 predicted 634
6 SASI_Mm01_00106188 predicted 247
7 SASI_Mm01_00106189 predicted 339
8 SASI_Mm01_00106190 predicted 783
9 SASI_Mm02_00328776 predicted 715
10 SASI_Mm01_00106191 predicted 600
11 SASI_Mm01_00106186 predicted 352
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145654
VALIDATED
RDM1 MISSION shRNA Bacterial Glycerol Stock
RAD52 motif 1
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145654.3-607s21c1
Sequence:CCGGGGTGGAGGAAGGACCATTATCCTCGAGGATAATGGTCCTTCCTCCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154689    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145654.2-917s1c1
Sequence:CCGGGCGAGGTCATGTAACTTCCTTCTCGAGAAGGAAGTTACATGACCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_145654.2-388s1c1
Sequence:CCGGGAACTGGCGAATTACTACTTTCTCGAGAAAGTAGTAATTCGCCAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145654.3-316s21c1
Sequence:CCGGTCCAGTCAAGGTTCGTCTTGGCTCGAGCCAAGACGAACCTTGACTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145654.3-915s21c1
Sequence:CCGGTATCCCAAGGCGAGGTCATGTCTCGAGACATGACCTCGCCTTGGGATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A3
TRC Version: 1 Clone ID:NM_145654.2-383s1c1
Sequence:CCGGGCCAAGAACTGGCGAATTACTCTCGAGAGTAATTCGCCAGTTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145654.3-405s21c1
Sequence:CCGGATTACTACTTTGGTTTCAATGCTCGAGCATTGAAACCAAAGTAGTAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145654.3-842s21c1
Sequence:CCGGGAAGGGTATCTCTCGGATTTCCTCGAGGAAATCCGAGAGATACCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145654.3-616s21c1
Sequence:CCGGAGGACCATTATCATTCCTTATCTCGAGATAAGGAATGATAATGGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145654.3-905s21c1
Sequence:CCGGCATTTCTGAATATCCCAAGGCCTCGAGGCCTTGGGATATTCAGAAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145654.3-760s21c1
Sequence:CCGGCGTAGGTGTCAGATGCGAAGACTCGAGTCTTCGCATCTGACACCTACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_145654.2-679s1c1
Sequence:CCGGGCATTCCAGAAACTGTTGATTCTCGAGAATCAACAGTTTCTGGAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_145654.2-769s1c1
Sequence:CCGGGAAGAAGAACTACACGGTTTACTCGAGTAAACCGTGTAGTTCTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145654.2-139s1c1
Sequence:CCGGCATTCTCTGTTCACAGCATTTCTCGAGAAATGCTGTGAACAGAGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145654.2-337s1c1
Sequence:CCGGCATAAGGCAGTTCAACATCAACTCGAGTTGATGTTGAACTGCCTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145654.3-707s21c1
Sequence:CCGGGTTGTTCTAGAAAGTGGTAAACTCGAGTTTACCACTTTCTAGAACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145654
VALIDATED
RDM1 MISSION shRNA shRNA Plasmid DNA
RAD52 motif 1
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145654.3-607s21c1
Sequence:CCGGGGTGGAGGAAGGACCATTATCCTCGAGGATAATGGTCCTTCCTCCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154689    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145654.2-917s1c1
Sequence:CCGGGCGAGGTCATGTAACTTCCTTCTCGAGAAGGAAGTTACATGACCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_145654.2-388s1c1
Sequence:CCGGGAACTGGCGAATTACTACTTTCTCGAGAAAGTAGTAATTCGCCAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145654.3-316s21c1
Sequence:CCGGTCCAGTCAAGGTTCGTCTTGGCTCGAGCCAAGACGAACCTTGACTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145654.3-915s21c1
Sequence:CCGGTATCCCAAGGCGAGGTCATGTCTCGAGACATGACCTCGCCTTGGGATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A3
TRC Version: 1 Clone ID:NM_145654.2-383s1c1
Sequence:CCGGGCCAAGAACTGGCGAATTACTCTCGAGAGTAATTCGCCAGTTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145654.3-405s21c1
Sequence:CCGGATTACTACTTTGGTTTCAATGCTCGAGCATTGAAACCAAAGTAGTAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145654.3-842s21c1
Sequence:CCGGGAAGGGTATCTCTCGGATTTCCTCGAGGAAATCCGAGAGATACCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145654.3-616s21c1
Sequence:CCGGAGGACCATTATCATTCCTTATCTCGAGATAAGGAATGATAATGGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145654.3-905s21c1
Sequence:CCGGCATTTCTGAATATCCCAAGGCCTCGAGGCCTTGGGATATTCAGAAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145654.3-760s21c1
Sequence:CCGGCGTAGGTGTCAGATGCGAAGACTCGAGTCTTCGCATCTGACACCTACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_145654.2-679s1c1
Sequence:CCGGGCATTCCAGAAACTGTTGATTCTCGAGAATCAACAGTTTCTGGAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_145654.2-769s1c1
Sequence:CCGGGAAGAAGAACTACACGGTTTACTCGAGTAAACCGTGTAGTTCTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145654.2-139s1c1
Sequence:CCGGCATTCTCTGTTCACAGCATTTCTCGAGAAATGCTGTGAACAGAGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145654.2-337s1c1
Sequence:CCGGCATAAGGCAGTTCAACATCAACTCGAGTTGATGTTGAACTGCCTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145654.3-707s21c1
Sequence:CCGGGTTGTTCTAGAAAGTGGTAAACTCGAGTTTACCACTTTCTAGAACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145654
VALIDATED
RDM1 MISSION shRNA Lentiviral Transduction Particles
RAD52 motif 1
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145654.3-607s21c1
Sequence:CCGGGGTGGAGGAAGGACCATTATCCTCGAGGATAATGGTCCTTCCTCCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154689    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145654.2-917s1c1
Sequence:CCGGGCGAGGTCATGTAACTTCCTTCTCGAGAAGGAAGTTACATGACCTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_145654.2-388s1c1
Sequence:CCGGGAACTGGCGAATTACTACTTTCTCGAGAAAGTAGTAATTCGCCAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145654.3-316s21c1
Sequence:CCGGTCCAGTCAAGGTTCGTCTTGGCTCGAGCCAAGACGAACCTTGACTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435383    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145654.3-915s21c1
Sequence:CCGGTATCCCAAGGCGAGGTCATGTCTCGAGACATGACCTCGCCTTGGGATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A3
TRC Version: 1 Clone ID:NM_145654.2-383s1c1
Sequence:CCGGGCCAAGAACTGGCGAATTACTCTCGAGAGTAATTCGCCAGTTCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145654.3-405s21c1
Sequence:CCGGATTACTACTTTGGTTTCAATGCTCGAGCATTGAAACCAAAGTAGTAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145654.3-842s21c1
Sequence:CCGGGAAGGGTATCTCTCGGATTTCCTCGAGGAAATCCGAGAGATACCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421571    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145654.3-616s21c1
Sequence:CCGGAGGACCATTATCATTCCTTATCTCGAGATAAGGAATGATAATGGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426508    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145654.3-905s21c1
Sequence:CCGGCATTTCTGAATATCCCAAGGCCTCGAGGCCTTGGGATATTCAGAAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145654.3-760s21c1
Sequence:CCGGCGTAGGTGTCAGATGCGAAGACTCGAGTCTTCGCATCTGACACCTACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_145654.2-679s1c1
Sequence:CCGGGCATTCCAGAAACTGTTGATTCTCGAGAATCAACAGTTTCTGGAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_145654.2-769s1c1
Sequence:CCGGGAAGAAGAACTACACGGTTTACTCGAGTAAACCGTGTAGTTCTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145654.2-139s1c1
Sequence:CCGGCATTCTCTGTTCACAGCATTTCTCGAGAAATGCTGTGAACAGAGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151995    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145654.2-337s1c1
Sequence:CCGGCATAAGGCAGTTCAACATCAACTCGAGTTGATGTTGAACTGCCTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145654.3-707s21c1
Sequence:CCGGGTTGTTCTAGAAAGTGGTAAACTCGAGTTTACCACTTTCTAGAACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025654
VALIDATED
RDM1 MISSION shRNA Bacterial Glycerol Stock
RAD52 motif 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025654.2-329s21c1
Sequence:CCGGGCATCAGGCCTTTGCTCTAAACTCGAGTTTAGAGCAAAGGCCTGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025654.2-101s21c1
Sequence:CCGGAGCCGAAGCCTTAAGTCATTCCTCGAGGAATGACTTAAGGCTTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025654.2-918s21c1
Sequence:CCGGGTTCTGCGTGTCCAATCAGTGCTCGAGCACTGATTGGACACGCAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025654.1-582s1c1
Sequence:CCGGGCAGTCCTCGTTTCTTATGAACTCGAGTTCATAAGAAACGAGGACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025654.2-359s21c1
Sequence:CCGGATGCCAGGAACTGGCCAATTACTCGAGTAATTGGCCAGTTCCTGGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025654.2-803s21c1
Sequence:CCGGGGAAGAATGTCTCTCGGATTTCTCGAGAAATCCGAGAGACATTCTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025654
VALIDATED
RDM1 MISSION shRNA shRNA Plasmid DNA
RAD52 motif 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025654.2-329s21c1
Sequence:CCGGGCATCAGGCCTTTGCTCTAAACTCGAGTTTAGAGCAAAGGCCTGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025654.2-101s21c1
Sequence:CCGGAGCCGAAGCCTTAAGTCATTCCTCGAGGAATGACTTAAGGCTTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025654.2-918s21c1
Sequence:CCGGGTTCTGCGTGTCCAATCAGTGCTCGAGCACTGATTGGACACGCAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025654.1-582s1c1
Sequence:CCGGGCAGTCCTCGTTTCTTATGAACTCGAGTTCATAAGAAACGAGGACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000246745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025654.2-359s21c1
Sequence:CCGGATGCCAGGAACTGGCCAATTACTCGAGTAATTGGCCAGTTCCTGGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025654.2-803s21c1
Sequence:CCGGGGAAGAATGTCTCTCGGATTTCTCGAGAAATCCGAGAGACATTCTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025654
VALIDATED
RDM1 MISSION shRNA Lentiviral Transduction Particles
RAD52 motif 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025654.2-329s21c1
Sequence:CCGGGCATCAGGCCTTTGCTCTAAACTCGAGTTTAGAGCAAAGGCCTGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025654.2-101s21c1
Sequence:CCGGAGCCGAAGCCTTAAGTCATTCCTCGAGGAATGACTTAAGGCTTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246746    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025654.2-918s21c1
Sequence:CCGGGTTCTGCGTGTCCAATCAGTGCTCGAGCACTGATTGGACACGCAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025654.1-582s1c1
Sequence:CCGGGCAGTCCTCGTTTCTTATGAACTCGAGTTCATAAGAAACGAGGACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000246745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025654.2-359s21c1
Sequence:CCGGATGCCAGGAACTGGCCAATTACTCGAGTAATTGGCCAGTTCCTGGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025654.2-803s21c1
Sequence:CCGGGGAAGAATGTCTCTCGGATTTCTCGAGAAATCCGAGAGACATTCTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)