EMAIL THIS PAGE TO A FRIEND

RDX

radixin

173 Gene Product Result for
Synonyms: DFNB24
Gene ID:
Human(5962) Summary: Radixin is a cytoskeletal protein that may be important in linking actin to the plasma membrane. It is highly similar in sequence to both ezrin and moesin. The radixin gene has been localized by fluorescence in situ hybridization to 11q23. A truncated version representing a pseudogene (RDXP2) was assigned to Xp21.3. Another pseudogene that seemed to lack introns (RDXP1) was mapped to 11p by Southern and PCR analyses. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Mouse(19684) radixin
Rat(315655) radixin
cow(517111) radixin
fruit fly(41704) roadkill
chicken(395511) radixin
dog(479446) radixin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504260 Anti-phospho-Moesin/Ezrin/Radixin (pThr558) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB2500859 Anti-Radixin antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, canine, rat
ELISA, western blot pricing
R3653 Anti-Radixin antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human, rat
immunofluorescence, immunoprecipitation (IP), western blot pricing
SAB1406381 Anti-RDX antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1412064 ANTI-RDX antibody produced in mouse clone 2E7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412065 ANTI-RDX antibody produced in mouse clone 1C4, ascites fluid human
ELISA, western blot pricing
HPA000263 Anti-RDX antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunohistochemistry, western blot pricing
HPA000763 Anti-RDX antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
WH0005962M1 Monoclonal Anti-RDX antibody produced in mouse clone 1E12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404307 Monoclonal Anti-RDX antibody produced in mouse clone 1D9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002906 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002906 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002906 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009041 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009041 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009041 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002906 Rosetta Predictions human pricing
NM_001005889 Rosetta Predictions rat pricing
NM_001104616 Rosetta Predictions mouse pricing
NM_001104617 Rosetta Predictions mouse pricing
NM_009041 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002906 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217536 predicted 494
2 SASI_Hs01_00217537 predicted 2046
3 SASI_Hs01_00217538 predicted 319
4 SASI_Hs01_00217539 predicted 620
5 SASI_Hs01_00217540 predicted 632
6 SASI_Hs01_00217541 predicted 1631
7 SASI_Hs02_00334718 predicted 2004
8 SASI_Hs01_00217542 predicted 471
9 SASI_Hs01_00217543 predicted 708
10 SASI_Hs01_00217544 predicted 1735
11 SASI_Hs01_00217545 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005889 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056814 predicted 936
2 SASI_Rn02_00198475 predicted 520
3 SASI_Rn01_00056815 predicted 755
4 SASI_Rn01_00056816 predicted 239
5 SASI_Rn01_00056817 predicted 879
6 SASI_Rn02_00198476 predicted 611
7 SASI_Rn01_00056818 predicted 1933
8 SASI_Rn01_00056819 predicted 396
9 SASI_Rn01_00056820 predicted 926
10 SASI_Rn01_00056821 predicted 542
11 SASI_Rn01_00056822 predicted 874
12 SASI_Rn01_00056823 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104616 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303550 predicted 836
2 SASI_Mm02_00303551 predicted 416
3 SASI_Mm02_00303552 predicted 454
4 SASI_Mm02_00303553 predicted 417
5 SASI_Mm02_00303554 predicted 795
6 SASI_Mm02_00303555 predicted 331
7 SASI_Mm02_00303556 predicted 482
8 SASI_Mm02_00303557 predicted 307
9 SASI_Mm02_00303558 predicted 560
10 SASI_Mm02_00303559 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104617 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303560 predicted 1239
2 SASI_Mm02_00303561 predicted 858
3 SASI_Mm02_00303562 predicted 825
4 SASI_Mm02_00303563 predicted 1203
5 SASI_Mm02_00303564 predicted 738
6 SASI_Mm02_00303565 predicted 1354
7 SASI_Mm02_00303566 predicted 885
8 SASI_Mm02_00303567 predicted 715
9 SASI_Mm02_00303568 predicted 962
10 SASI_Mm02_00303569 predicted 776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009041 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043755 predicted 1241
2 SASI_Mm01_00043758 predicted 862
3 SASI_Mm02_00315195 predicted 825
4 SASI_Mm02_00315196 predicted 1200
5 SASI_Mm02_00315197 predicted 742
6 SASI_Mm02_00315198 predicted 1357
7 SASI_Mm01_00043760 predicted 889
8 SASI_Mm02_00315199 predicted 718
9 SASI_Mm01_00043762 predicted 969
10 SASI_Mm01_00043763 predicted 773
11 SASI_Mm01_00043756 predicted 826
12 SASI_Mm01_00043757 predicted 904
13 SASI_Mm01_00043759 predicted 1926
14 SASI_Mm01_00043761 predicted 1859
15 SASI_Mm01_00043764 predicted 1493
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002906
RDX MISSION shRNA Bacterial Glycerol Stock
radixin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000414986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002906.3-1885s21c1
Sequence:CCGGGAAGCAACTTCAGGCATTAAGCTCGAGCTTAATGCCTGAAGTTGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002906.3-993s21c1
Sequence:CCGGATGAGCATGACGACAAGTTAACTCGAGTTAACTTGTCGTCATGCTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002906.2-274s1c1
Sequence:CCGGGCTAAATTCTTTCCTGAAGATCTCGAGATCTTCAGGAAAGAATTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002906.2-496s1c1
Sequence:CCGGCGTGTATTGGAACAACACAAACTCGAGTTTGTGTTGTTCCAATACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002906.2-1642s1c1
Sequence:CCGGGCCAGAGATGAAACCAAGAAACTCGAGTTTCTTGGTTTCATCTCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002906.2-1098s1c1
Sequence:CCGGGCAGACAATTAAAGCTCAGAACTCGAGTTCTGAGCTTTAATTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002906.2-874s1c1
Sequence:CCGGGCCTTATGTATGGGAAACCATCTCGAGATGGTTTCCCATACATAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002906
RDX MISSION shRNA shRNA Plasmid DNA
radixin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000414986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002906.3-1885s21c1
Sequence:CCGGGAAGCAACTTCAGGCATTAAGCTCGAGCTTAATGCCTGAAGTTGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002906.3-993s21c1
Sequence:CCGGATGAGCATGACGACAAGTTAACTCGAGTTAACTTGTCGTCATGCTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002906.2-274s1c1
Sequence:CCGGGCTAAATTCTTTCCTGAAGATCTCGAGATCTTCAGGAAAGAATTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002906.2-496s1c1
Sequence:CCGGCGTGTATTGGAACAACACAAACTCGAGTTTGTGTTGTTCCAATACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002906.2-1642s1c1
Sequence:CCGGGCCAGAGATGAAACCAAGAAACTCGAGTTTCTTGGTTTCATCTCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002906.2-1098s1c1
Sequence:CCGGGCAGACAATTAAAGCTCAGAACTCGAGTTCTGAGCTTTAATTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002906.2-874s1c1
Sequence:CCGGGCCTTATGTATGGGAAACCATCTCGAGATGGTTTCCCATACATAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002906
RDX MISSION shRNA Lentiviral Transduction Particles
radixin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000414986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002906.3-1885s21c1
Sequence:CCGGGAAGCAACTTCAGGCATTAAGCTCGAGCTTAATGCCTGAAGTTGCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002906.3-993s21c1
Sequence:CCGGATGAGCATGACGACAAGTTAACTCGAGTTAACTTGTCGTCATGCTCATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002906.2-274s1c1
Sequence:CCGGGCTAAATTCTTTCCTGAAGATCTCGAGATCTTCAGGAAAGAATTTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002906.2-496s1c1
Sequence:CCGGCGTGTATTGGAACAACACAAACTCGAGTTTGTGTTGTTCCAATACACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002906.2-1642s1c1
Sequence:CCGGGCCAGAGATGAAACCAAGAAACTCGAGTTTCTTGGTTTCATCTCTGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002906.2-1098s1c1
Sequence:CCGGGCAGACAATTAAAGCTCAGAACTCGAGTTCTGAGCTTTAATTGTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002906.2-874s1c1
Sequence:CCGGGCCTTATGTATGGGAAACCATCTCGAGATGGTTTCCCATACATAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009041
VALIDATED
RDX MISSION shRNA Bacterial Glycerol Stock
radixin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009041.3-1366s21c1
Sequence:CCGGCCTCGTCTGAGAATCAATAAACTCGAGTTTATTGATTCTCAGACGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009041.3-865s21c1
Sequence:CCGGCAAGTTAAAGAAGCCATCTTACTCGAGTAAGATGGCTTCTTTAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009041.3-2147s21c1
Sequence:CCGGGTTCAGAATTAGCCCAAGCTACTCGAGTAGCTTGGGCTAATTCTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009041.3-1502s21c1
Sequence:CCGGAGCTAGAAAGGGCACAATTAGCTCGAGCTAATTGTGCCCTTTCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009041.3-1135s21c1
Sequence:CCGGGCGCAAGATCTAGAGATGTATCTCGAGATACATCTCTAGATCTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009041.1-478s1c1
Sequence:CCGGCAAGTTAAAGAAGCCATCTTACTCGAGTAAGATGGCTTCTTTAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009041.1-748s1c1
Sequence:CCGGGCGCAAGATCTAGAGATGTATCTCGAGATACATCTCTAGATCTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009041.1-229s1c1
Sequence:CCGGCCCAATACAACTGGCAAACAACTCGAGTTGTTTGCCAGTTGTATTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000072062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009041.1-1760s1c1
Sequence:CCGGGTTCAGAATTAGCCCAAGCTACTCGAGTAGCTTGGGCTAATTCTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009041.3-2596s21c1
Sequence:CCGGTAATGGCCACGTCTGACAAATCTCGAGATTTGTCAGACGTGGCCATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009041
VALIDATED
RDX MISSION shRNA shRNA Plasmid DNA
radixin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009041.3-1366s21c1
Sequence:CCGGCCTCGTCTGAGAATCAATAAACTCGAGTTTATTGATTCTCAGACGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009041.3-865s21c1
Sequence:CCGGCAAGTTAAAGAAGCCATCTTACTCGAGTAAGATGGCTTCTTTAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009041.3-2147s21c1
Sequence:CCGGGTTCAGAATTAGCCCAAGCTACTCGAGTAGCTTGGGCTAATTCTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009041.3-1502s21c1
Sequence:CCGGAGCTAGAAAGGGCACAATTAGCTCGAGCTAATTGTGCCCTTTCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009041.3-1135s21c1
Sequence:CCGGGCGCAAGATCTAGAGATGTATCTCGAGATACATCTCTAGATCTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009041.1-478s1c1
Sequence:CCGGCAAGTTAAAGAAGCCATCTTACTCGAGTAAGATGGCTTCTTTAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009041.1-748s1c1
Sequence:CCGGGCGCAAGATCTAGAGATGTATCTCGAGATACATCTCTAGATCTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009041.1-229s1c1
Sequence:CCGGCCCAATACAACTGGCAAACAACTCGAGTTGTTTGCCAGTTGTATTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009041.1-1760s1c1
Sequence:CCGGGTTCAGAATTAGCCCAAGCTACTCGAGTAGCTTGGGCTAATTCTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009041.3-2596s21c1
Sequence:CCGGTAATGGCCACGTCTGACAAATCTCGAGATTTGTCAGACGTGGCCATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009041
VALIDATED
RDX MISSION shRNA Lentiviral Transduction Particles
radixin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009041.3-1366s21c1
Sequence:CCGGCCTCGTCTGAGAATCAATAAACTCGAGTTTATTGATTCTCAGACGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009041.3-865s21c1
Sequence:CCGGCAAGTTAAAGAAGCCATCTTACTCGAGTAAGATGGCTTCTTTAACTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009041.3-2147s21c1
Sequence:CCGGGTTCAGAATTAGCCCAAGCTACTCGAGTAGCTTGGGCTAATTCTGAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377088    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009041.3-1502s21c1
Sequence:CCGGAGCTAGAAAGGGCACAATTAGCTCGAGCTAATTGTGCCCTTTCTAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352120    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009041.3-1135s21c1
Sequence:CCGGGCGCAAGATCTAGAGATGTATCTCGAGATACATCTCTAGATCTTGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009041.1-478s1c1
Sequence:CCGGCAAGTTAAAGAAGCCATCTTACTCGAGTAAGATGGCTTCTTTAACTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009041.1-748s1c1
Sequence:CCGGGCGCAAGATCTAGAGATGTATCTCGAGATACATCTCTAGATCTTGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009041.1-229s1c1
Sequence:CCGGCCCAATACAACTGGCAAACAACTCGAGTTGTTTGCCAGTTGTATTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000072062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009041.1-1760s1c1
Sequence:CCGGGTTCAGAATTAGCCCAAGCTACTCGAGTAGCTTGGGCTAATTCTGAACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363893    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009041.3-2596s21c1
Sequence:CCGGTAATGGCCACGTCTGACAAATCTCGAGATTTGTCAGACGTGGCCATTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)