EMAIL THIS PAGE TO A FRIEND

RECK

reversion-inducing-cysteine-rich protein with kazal motifs

243 Gene Product Result for
Synonyms: ST15
UniProtKB ID: O95980, B2RNS1, Q5W0K6, Q8WX37
Gene ID:
Human(8434) Summary: The protein encoded by this gene is a cysteine-rich, extracellular protein with protease inhibitor-like domains whose expression is suppressed strongly in many tumors and cells transformed by various kinds of oncogenes. In normal cells, this membrane-anchored glycoprotein may serve as a negative regulator for matrix metalloproteinase-9, a key enzyme involved in tumor invasion and metastasis. [provided by RefSeq, Jul 2008]
Mouse(53614) reversion-inducing-cysteine-rich protein with kazal motifs
Rat(313488) reversion-inducing-cysteine-rich protein with kazal motifs
fruit fly(39629) Reversion-inducing-cysteine-rich protein with kazal motifs
chicken(420804) reversion-inducing-cysteine-rich protein with kazal motifs
domestic cat(101088789) reversion-inducing-cysteine-rich protein with kazal motifs
dog(403477) reversion-inducing-cysteine-rich protein with kazal motifs
cow(517232) reversion-inducing-cysteine-rich protein with kazal motifs
sheep(101107077) reversion-inducing-cysteine-rich protein with kazal motifs
domestic guinea pig(100730551) reversion-inducing-cysteine-rich protein with kazal motifs
naked mole-rat(101710211) reversion-inducing-cysteine-rich protein with kazal motifs
Domestic Rabbit(100353073) reversion-inducing-cysteine-rich protein with kazal motifs
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021111 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021111 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021111 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016678 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016678 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016678 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021111 Rosetta Predictions human pricing
NM_001107954 Rosetta Predictions rat pricing
NM_016678 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354607 predicted 1592
2 SASI_Hs01_00157822 predicted 1853
3 SASI_Hs01_00157823 predicted 683
4 SASI_Hs02_00354608 predicted 2282
5 SASI_Hs01_00157824 predicted 1004
6 SASI_Hs01_00157825 predicted 1138
7 SASI_Hs01_00157826 predicted 1770
8 SASI_Hs02_00354609 predicted 1330
9 SASI_Hs01_00157827 predicted 2104
10 SASI_Hs01_00157829 predicted 2608
11 SASI_Hs01_00157821 predicted 1803
12 SASI_Hs01_00157828 predicted 2004
13 SASI_Hs01_00157830 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107954 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233925 predicted 486
2 SASI_Rn02_00233926 predicted 395
3 SASI_Rn02_00233927 predicted 1992
4 SASI_Rn02_00233928 predicted 1300
5 SASI_Rn02_00233929 predicted 1761
6 SASI_Rn02_00233930 predicted 1681
7 SASI_Rn02_00233931 predicted 1930
8 SASI_Rn02_00233932 predicted 1599
9 SASI_Rn02_00233933 predicted 2859
10 SASI_Rn02_00233934 predicted 1256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016678 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065331 predicted 1364
2 SASI_Mm02_00323314 predicted 1322
3 SASI_Mm02_00323315 predicted 1237
4 SASI_Mm02_00323316 predicted 198
5 SASI_Mm01_00065334 predicted 1129
6 SASI_Mm01_00065336 predicted 792
7 SASI_Mm01_00065337 predicted 1376
8 SASI_Mm02_00323317 predicted 2718
9 SASI_Mm02_00323318 predicted 1341
10 SASI_Mm01_00065339 predicted 1998
11 SASI_Mm01_00065332 predicted 495
12 SASI_Mm01_00065333 predicted 1914
13 SASI_Mm01_00065335 predicted 702
14 SASI_Mm01_00065338 predicted 1780
15 SASI_Mm01_00065340 predicted 738
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021111
VALIDATED
RECK MISSION shRNA Bacterial Glycerol Stock
reversion-inducing-cysteine-rich protein with kazal motifs
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021111.2-2419s21c1
Sequence:CCGGGCGTGGCAGTCGATTACTATGCTCGAGCATAGTAATCGACTGCCACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021111.2-1515s21c1
Sequence:CCGGTACCTCAGGCCAAGTACTTTACTCGAGTAAAGTACTTGGCCTGAGGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021111.2-3147s21c1
Sequence:CCGGCCGCCAATATTAGTAGGATTTCTCGAGAAATCCTACTAATATTGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021111.2-708s21c1
Sequence:CCGGAGGAACCCAACGGATAGTTTACTCGAGTAAACTATCCGTTGGGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021111.2-1142s21c1
Sequence:CCGGCCTTACTTACTGTACTAATTTCTCGAGAAATTAGTACAGTAAGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021111.2-677s21c1
Sequence:CCGGTGTGAACAATTATACTCAATCCTCGAGGATTGAGTATAATTGTTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021111.1-3612s1c1
Sequence:CCGGGCTGATTAAATGACACTCATACTCGAGTATGAGTGTCATTTAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021111.1-653s1c1
Sequence:CCGGCGCCTCTATTAGTCCACAATTCTCGAGAATTGTGGACTAATAGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021111.1-962s1c1
Sequence:CCGGGCATTGTTGTTCTAAAGCAAACTCGAGTTTGCTTTAGAACAACAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021111.1-1998s1c1
Sequence:CCGGGCAGATCAGTTTGTCCCTGTACTCGAGTACAGGGACAAACTGATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021111.1-652s1c1
Sequence:CCGGGCGCCTCTATTAGTCCACAATCTCGAGATTGTGGACTAATAGAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021111
VALIDATED
RECK MISSION shRNA shRNA Plasmid DNA
reversion-inducing-cysteine-rich protein with kazal motifs
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021111.2-2419s21c1
Sequence:CCGGGCGTGGCAGTCGATTACTATGCTCGAGCATAGTAATCGACTGCCACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021111.2-1515s21c1
Sequence:CCGGTACCTCAGGCCAAGTACTTTACTCGAGTAAAGTACTTGGCCTGAGGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021111.2-3147s21c1
Sequence:CCGGCCGCCAATATTAGTAGGATTTCTCGAGAAATCCTACTAATATTGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021111.2-708s21c1
Sequence:CCGGAGGAACCCAACGGATAGTTTACTCGAGTAAACTATCCGTTGGGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021111.2-1142s21c1
Sequence:CCGGCCTTACTTACTGTACTAATTTCTCGAGAAATTAGTACAGTAAGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021111.2-677s21c1
Sequence:CCGGTGTGAACAATTATACTCAATCCTCGAGGATTGAGTATAATTGTTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021111.1-3612s1c1
Sequence:CCGGGCTGATTAAATGACACTCATACTCGAGTATGAGTGTCATTTAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021111.1-653s1c1
Sequence:CCGGCGCCTCTATTAGTCCACAATTCTCGAGAATTGTGGACTAATAGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021111.1-962s1c1
Sequence:CCGGGCATTGTTGTTCTAAAGCAAACTCGAGTTTGCTTTAGAACAACAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021111.1-1998s1c1
Sequence:CCGGGCAGATCAGTTTGTCCCTGTACTCGAGTACAGGGACAAACTGATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000073525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021111.1-652s1c1
Sequence:CCGGGCGCCTCTATTAGTCCACAATCTCGAGATTGTGGACTAATAGAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021111
VALIDATED
RECK MISSION shRNA Lentiviral Transduction Particles
reversion-inducing-cysteine-rich protein with kazal motifs
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021111.2-2419s21c1
Sequence:CCGGGCGTGGCAGTCGATTACTATGCTCGAGCATAGTAATCGACTGCCACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021111.2-1515s21c1
Sequence:CCGGTACCTCAGGCCAAGTACTTTACTCGAGTAAAGTACTTGGCCTGAGGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369962    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021111.2-3147s21c1
Sequence:CCGGCCGCCAATATTAGTAGGATTTCTCGAGAAATCCTACTAATATTGGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364972    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021111.2-708s21c1
Sequence:CCGGAGGAACCCAACGGATAGTTTACTCGAGTAAACTATCCGTTGGGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021111.2-1142s21c1
Sequence:CCGGCCTTACTTACTGTACTAATTTCTCGAGAAATTAGTACAGTAAGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_021111.2-677s21c1
Sequence:CCGGTGTGAACAATTATACTCAATCCTCGAGGATTGAGTATAATTGTTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021111.1-3612s1c1
Sequence:CCGGGCTGATTAAATGACACTCATACTCGAGTATGAGTGTCATTTAATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021111.1-653s1c1
Sequence:CCGGCGCCTCTATTAGTCCACAATTCTCGAGAATTGTGGACTAATAGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021111.1-962s1c1
Sequence:CCGGGCATTGTTGTTCTAAAGCAAACTCGAGTTTGCTTTAGAACAACAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021111.1-1998s1c1
Sequence:CCGGGCAGATCAGTTTGTCCCTGTACTCGAGTACAGGGACAAACTGATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000073525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021111.1-652s1c1
Sequence:CCGGGCGCCTCTATTAGTCCACAATCTCGAGATTGTGGACTAATAGAGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016678
VALIDATED
RECK MISSION shRNA Bacterial Glycerol Stock
reversion-inducing-cysteine-rich protein with kazal motifs
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016678.2-3649s21c1
Sequence:CCGGCCGTGTTGTGTTAGCCAGATACTCGAGTATCTGGCTAACACAACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016678.2-1043s21c1
Sequence:CCGGGACCGCATCTGTGAGTATAATCTCGAGATTATACTCACAGATGCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016678.2-2562s21c1
Sequence:CCGGCTGGGATGTTACGGGTATTATCTCGAGATAATACCCGTAACATCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016678.2-809s21c1
Sequence:CCGGGGTCTCATTGAGGGTTGTAAGCTCGAGCTTACAACCCTCAATGAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016678.2-1802s21c1
Sequence:CCGGGACCTCCAGAAGTCTTGTATTCTCGAGAATACAAGACTTCTGGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016678.1-3596s1c1
Sequence:CCGGCCGTGTTGTGTTAGCCAGATACTCGAGTATCTGGCTAACACAACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016678.1-2503s1c1
Sequence:CCGGCGGGTATTATTTGACAAAGAACTCGAGTTCTTTGTCAAATAATACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016678.1-1773s1c1
Sequence:CCGGCCACGGAACATCCTTTACTATCTCGAGATAGTAAAGGATGTTCCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016678.1-229s1c1
Sequence:CCGGCCTGAAACAATGGTTGAAATTCTCGAGAATTTCAACCATTGTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016678.1-227s1c1
Sequence:CCGGGCCCTGAAACAATGGTTGAAACTCGAGTTTCAACCATTGTTTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016678.2-2705s21c1
Sequence:CCGGTTGAGCATCGAGTCGGAAATTCTCGAGAATTTCCGACTCGATGCTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016678
VALIDATED
RECK MISSION shRNA shRNA Plasmid DNA
reversion-inducing-cysteine-rich protein with kazal motifs
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016678.2-3649s21c1
Sequence:CCGGCCGTGTTGTGTTAGCCAGATACTCGAGTATCTGGCTAACACAACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016678.2-1043s21c1
Sequence:CCGGGACCGCATCTGTGAGTATAATCTCGAGATTATACTCACAGATGCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016678.2-2562s21c1
Sequence:CCGGCTGGGATGTTACGGGTATTATCTCGAGATAATACCCGTAACATCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016678.2-809s21c1
Sequence:CCGGGGTCTCATTGAGGGTTGTAAGCTCGAGCTTACAACCCTCAATGAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016678.2-1802s21c1
Sequence:CCGGGACCTCCAGAAGTCTTGTATTCTCGAGAATACAAGACTTCTGGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016678.1-3596s1c1
Sequence:CCGGCCGTGTTGTGTTAGCCAGATACTCGAGTATCTGGCTAACACAACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016678.1-2503s1c1
Sequence:CCGGCGGGTATTATTTGACAAAGAACTCGAGTTCTTTGTCAAATAATACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016678.1-1773s1c1
Sequence:CCGGCCACGGAACATCCTTTACTATCTCGAGATAGTAAAGGATGTTCCGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016678.1-229s1c1
Sequence:CCGGCCTGAAACAATGGTTGAAATTCTCGAGAATTTCAACCATTGTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000080129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016678.1-227s1c1
Sequence:CCGGGCCCTGAAACAATGGTTGAAACTCGAGTTTCAACCATTGTTTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016678.2-2705s21c1
Sequence:CCGGTTGAGCATCGAGTCGGAAATTCTCGAGAATTTCCGACTCGATGCTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016678
VALIDATED
RECK MISSION shRNA Lentiviral Transduction Particles
reversion-inducing-cysteine-rich protein with kazal motifs
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317336    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016678.2-3649s21c1
Sequence:CCGGCCGTGTTGTGTTAGCCAGATACTCGAGTATCTGGCTAACACAACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016678.2-1043s21c1
Sequence:CCGGGACCGCATCTGTGAGTATAATCTCGAGATTATACTCACAGATGCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016678.2-2562s21c1
Sequence:CCGGCTGGGATGTTACGGGTATTATCTCGAGATAATACCCGTAACATCCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016678.2-809s21c1
Sequence:CCGGGGTCTCATTGAGGGTTGTAAGCTCGAGCTTACAACCCTCAATGAGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016678.2-1802s21c1
Sequence:CCGGGACCTCCAGAAGTCTTGTATTCTCGAGAATACAAGACTTCTGGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080128    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016678.1-3596s1c1
Sequence:CCGGCCGTGTTGTGTTAGCCAGATACTCGAGTATCTGGCTAACACAACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016678.1-2503s1c1
Sequence:CCGGCGGGTATTATTTGACAAAGAACTCGAGTTCTTTGTCAAATAATACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016678.1-1773s1c1
Sequence:CCGGCCACGGAACATCCTTTACTATCTCGAGATAGTAAAGGATGTTCCGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016678.1-229s1c1
Sequence:CCGGCCTGAAACAATGGTTGAAATTCTCGAGAATTTCAACCATTGTTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000080129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016678.1-227s1c1
Sequence:CCGGGCCCTGAAACAATGGTTGAAACTCGAGTTTCAACCATTGTTTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313815    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016678.2-2705s21c1
Sequence:CCGGTTGAGCATCGAGTCGGAAATTCTCGAGAATTTCCGACTCGATGCTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)