EMAIL THIS PAGE TO A FRIEND

RECQL5

RecQ protein-like 5

102 Gene Product Result for
Synonyms: RECQ5
UniProtKB ID: O94762, Q9H0B1, Q9P1W7, Q9UNC8
Gene ID:
Human(9400) Summary: The protein encoded by this gene is a helicase that is important for genome stability. The encoded protein also prevents aberrant homologous recombination by displacing RAD51 from ssDNA. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
Mouse(170472) RecQ protein-like 5
Rat(287834) RecQ protein-like 5
naked mole-rat(101724970) RecQ protein-like 5
domestic guinea pig(100718156) RecQ protein-like 5
cow(512590) RecQ protein-like 5
sheep(101109464) RecQ protein-like 5
Zebrafish(566553) RecQ protein-like 5
chicken(373891) RecQ protein-like 5
dog(483317) RecQ protein-like 5
Horse(100059566) RecQ protein-like 5
domestic cat(101101016) RecQ protein-like 5
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003715 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003715 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003715 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_130454 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130454 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130454 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003715 Rosetta Predictions human pricing
NM_001003716 Rosetta Predictions human pricing
NM_004259 Rosetta Predictions human pricing
NM_001105853 Rosetta Predictions rat pricing
NM_130454 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304354 predicted 282
2 SASI_Hs01_00055880 predicted 923
3 SASI_Hs02_00304355 predicted 389
4 SASI_Hs02_00304356 predicted 1141
5 SASI_Hs02_00304357 predicted 222
6 SASI_Hs01_00055883 predicted 1004
7 SASI_Hs02_00304358 predicted 419
8 SASI_Hs01_00055887 predicted 853
9 SASI_Hs01_00055888 predicted 845
10 SASI_Hs02_00304359 predicted 959
11 SASI_Hs01_00055881 predicted 1169
12 SASI_Hs01_00055882 predicted 1153
13 SASI_Hs01_00055884 predicted 1079
14 SASI_Hs01_00055885 predicted 796
15 SASI_Hs01_00055886 predicted 756
16 SASI_Hs01_00055889 predicted 962
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003716 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304360 predicted 281
2 SASI_Hs01_00208464 predicted 924
3 SASI_Hs02_00304361 predicted 383
4 SASI_Hs02_00304362 predicted 1143
5 SASI_Hs02_00304363 predicted 220
6 SASI_Hs01_00208467 predicted 1001
7 SASI_Hs02_00304364 predicted 424
8 SASI_Hs01_00208471 predicted 847
9 SASI_Hs01_00208472 predicted 844
10 SASI_Hs02_00304365 predicted 956
11 SASI_Hs01_00208465 predicted 1168
12 SASI_Hs01_00208466 predicted 1156
13 SASI_Hs01_00208468 predicted 1082
14 SASI_Hs01_00208469 predicted 793
15 SASI_Hs01_00208470 predicted 753
16 SASI_Hs01_00208473 predicted 965
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337211 predicted 280
2 SASI_Hs01_00223593 predicted 916
3 SASI_Hs02_00337212 predicted 385
4 SASI_Hs02_00337213 predicted 1136
5 SASI_Hs02_00337214 predicted 213
6 SASI_Hs01_00223596 predicted 1002
7 SASI_Hs02_00337215 predicted 416
8 SASI_Hs01_00223600 predicted 852
9 SASI_Hs01_00223601 predicted 837
10 SASI_Hs02_00337216 predicted 948
11 SASI_Hs01_00223594 predicted 1087
12 SASI_Hs01_00223595 predicted 1072
13 SASI_Hs01_00223597 predicted 1003
14 SASI_Hs01_00223598 predicted 711
15 SASI_Hs01_00223599 predicted 672
16 SASI_Hs01_00223602 predicted 884
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105853 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00213172 predicted 1008
2 SASI_Rn02_00213173 predicted 1650
3 SASI_Rn02_00213174 predicted 716
4 SASI_Rn02_00213175 predicted 650
5 SASI_Rn02_00213176 predicted 1433
6 SASI_Rn02_00213177 predicted 2046
7 SASI_Rn02_00213178 predicted 3268
8 SASI_Rn02_00213179 predicted 1303
9 SASI_Rn02_00213180 predicted 998
10 SASI_Rn02_00213181 predicted 3419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130454 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056366 predicted 552
2 SASI_Mm01_00056367 predicted 1073
3 SASI_Mm01_00056368 predicted 1195
4 SASI_Mm01_00056370 predicted 314
5 SASI_Mm01_00056371 predicted 1054
6 SASI_Mm01_00056372 predicted 2834
7 SASI_Mm01_00056373 predicted 1082
8 SASI_Mm01_00056374 predicted 1476
9 SASI_Mm02_00338260 predicted 436
10 SASI_Mm02_00338261 predicted 2895
11 SASI_Mm01_00056365 predicted 1024
12 SASI_Mm01_00056369 predicted 1644
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003715
VALIDATED
RECQL5 MISSION shRNA Bacterial Glycerol Stock
RecQ protein-like 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003715.1-1340s1c1
Sequence:CCGGGCCACTATCATGGCCTTTGATCTCGAGATCAAAGGCCATGATAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003715.1-2905s1c1
Sequence:CCGGGCCTTGTGTTTAGACCTGGATCTCGAGATCCAGGTCTAAACACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000051414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003715.1-1238s1c1
Sequence:CCGGCGTCTCTATTACTCCAGGAATCTCGAGATTCCTGGAGTAATAGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003715.2-1580s21c1
Sequence:CCGGTCAGACTTAGAGGTGAATAAACTCGAGTTTATTCACCTCTAAGTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003715.2-1149s21c1
Sequence:CCGGTTGTCGCCCATTGGAATATTGCTCGAGCAATATTCCAATGGGCGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003715.2-268s21c1
Sequence:CCGGTGCGACCATGGCTGTAGTAAACTCGAGTTTACTACAGCCATGGTCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003715.2-213s21c1
Sequence:CCGGGTACGCTGAAGAAGGTCTTTGCTCGAGCAAAGACCTTCTTCAGCGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003715.2-1092s21c1
Sequence:CCGGCTGTAATTGTTGCAACCATTACTCGAGTAATGGTTGCAACAATTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003715
VALIDATED
RECQL5 MISSION shRNA shRNA Plasmid DNA
RecQ protein-like 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003715.1-1340s1c1
Sequence:CCGGGCCACTATCATGGCCTTTGATCTCGAGATCAAAGGCCATGATAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003715.1-2905s1c1
Sequence:CCGGGCCTTGTGTTTAGACCTGGATCTCGAGATCCAGGTCTAAACACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000051414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003715.1-1238s1c1
Sequence:CCGGCGTCTCTATTACTCCAGGAATCTCGAGATTCCTGGAGTAATAGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003715.2-1580s21c1
Sequence:CCGGTCAGACTTAGAGGTGAATAAACTCGAGTTTATTCACCTCTAAGTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003715.2-1149s21c1
Sequence:CCGGTTGTCGCCCATTGGAATATTGCTCGAGCAATATTCCAATGGGCGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003715.2-268s21c1
Sequence:CCGGTGCGACCATGGCTGTAGTAAACTCGAGTTTACTACAGCCATGGTCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003715.2-213s21c1
Sequence:CCGGGTACGCTGAAGAAGGTCTTTGCTCGAGCAAAGACCTTCTTCAGCGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003715.2-1092s21c1
Sequence:CCGGCTGTAATTGTTGCAACCATTACTCGAGTAATGGTTGCAACAATTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003715
VALIDATED
RECQL5 MISSION shRNA Lentiviral Transduction Particles
RecQ protein-like 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003715.1-1340s1c1
Sequence:CCGGGCCACTATCATGGCCTTTGATCTCGAGATCAAAGGCCATGATAGTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000051413    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001003715.1-2905s1c1
Sequence:CCGGGCCTTGTGTTTAGACCTGGATCTCGAGATCCAGGTCTAAACACAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000051414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003715.1-1238s1c1
Sequence:CCGGCGTCTCTATTACTCCAGGAATCTCGAGATTCCTGGAGTAATAGAGACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000236024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001003715.2-1580s21c1
Sequence:CCGGTCAGACTTAGAGGTGAATAAACTCGAGTTTATTCACCTCTAAGTCTGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000236026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003715.2-1149s21c1
Sequence:CCGGTTGTCGCCCATTGGAATATTGCTCGAGCAATATTCCAATGGGCGACAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000236028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003715.2-268s21c1
Sequence:CCGGTGCGACCATGGCTGTAGTAAACTCGAGTTTACTACAGCCATGGTCGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000236027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003715.2-213s21c1
Sequence:CCGGGTACGCTGAAGAAGGTCTTTGCTCGAGCAAAGACCTTCTTCAGCGTACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000236025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_001003715.2-1092s21c1
Sequence:CCGGCTGTAATTGTTGCAACCATTACTCGAGTAATGGTTGCAACAATTACAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130454
VALIDATED
RECQL5 MISSION shRNA Bacterial Glycerol Stock
RecQ protein-like 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130454.1-1406s1c1
Sequence:CCGGGCCATAACGAAGAAGCTGGATCTCGAGATCCAGCTTCTTCGTTATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130454.1-902s1c1
Sequence:CCGGGCTTGTGAACAACTGGCCATTCTCGAGAATGGCCAGTTGTTCACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130454.1-1168s1c1
Sequence:CCGGCCGCCTGTATTACTCTAGGAACTCGAGTTCCTAGAGTAATACAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130454.1-1021s1c1
Sequence:CCGGCCCTGTAATTGTTGCGACCATCTCGAGATGGTCGCAACAATTACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115221    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130454.1-3212s1c1
Sequence:CCGGCCTAGATGAGAAGGTCCAGATCTCGAGATCTGGACCTTCTCATCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130454.1-902s21c1
Sequence:CCGGGCTTGTGAACAACTGGCCATTCTCGAGAATGGCCAGTTGTTCACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130454.1-590s21c1
Sequence:CCGGGACTTCCGTCCTGACTATTTGCTCGAGCAAATAGTCAGGACGGAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130454.1-1168s21c1
Sequence:CCGGCCGCCTGTATTACTCTAGGAACTCGAGTTCCTAGAGTAATACAGGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130454.1-3160s21c1
Sequence:CCGGTCAGACCACCCTCCCATTTAACTCGAGTTAAATGGGAGGGTGGTCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130454.1-2840s21c1
Sequence:CCGGTACAAGGAGGGCAGGTTTATACTCGAGTATAAACCTGCCCTCCTTGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130454
VALIDATED
RECQL5 MISSION shRNA shRNA Plasmid DNA
RecQ protein-like 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130454.1-1406s1c1
Sequence:CCGGGCCATAACGAAGAAGCTGGATCTCGAGATCCAGCTTCTTCGTTATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130454.1-902s1c1
Sequence:CCGGGCTTGTGAACAACTGGCCATTCTCGAGAATGGCCAGTTGTTCACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130454.1-1168s1c1
Sequence:CCGGCCGCCTGTATTACTCTAGGAACTCGAGTTCCTAGAGTAATACAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130454.1-1021s1c1
Sequence:CCGGCCCTGTAATTGTTGCGACCATCTCGAGATGGTCGCAACAATTACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115221    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130454.1-3212s1c1
Sequence:CCGGCCTAGATGAGAAGGTCCAGATCTCGAGATCTGGACCTTCTCATCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130454.1-902s21c1
Sequence:CCGGGCTTGTGAACAACTGGCCATTCTCGAGAATGGCCAGTTGTTCACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130454.1-590s21c1
Sequence:CCGGGACTTCCGTCCTGACTATTTGCTCGAGCAAATAGTCAGGACGGAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130454.1-1168s21c1
Sequence:CCGGCCGCCTGTATTACTCTAGGAACTCGAGTTCCTAGAGTAATACAGGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130454.1-3160s21c1
Sequence:CCGGTCAGACCACCCTCCCATTTAACTCGAGTTAAATGGGAGGGTGGTCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130454.1-2840s21c1
Sequence:CCGGTACAAGGAGGGCAGGTTTATACTCGAGTATAAACCTGCCCTCCTTGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130454
VALIDATED
RECQL5 MISSION shRNA Lentiviral Transduction Particles
RecQ protein-like 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130454.1-1406s1c1
Sequence:CCGGGCCATAACGAAGAAGCTGGATCTCGAGATCCAGCTTCTTCGTTATGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000115225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130454.1-902s1c1
Sequence:CCGGGCTTGTGAACAACTGGCCATTCTCGAGAATGGCCAGTTGTTCACAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000115222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130454.1-1168s1c1
Sequence:CCGGCCGCCTGTATTACTCTAGGAACTCGAGTTCCTAGAGTAATACAGGCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000115223    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130454.1-1021s1c1
Sequence:CCGGCCCTGTAATTGTTGCGACCATCTCGAGATGGTCGCAACAATTACAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000115221    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130454.1-3212s1c1
Sequence:CCGGCCTAGATGAGAAGGTCCAGATCTCGAGATCTGGACCTTCTCATCTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000328934    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130454.1-902s21c1
Sequence:CCGGGCTTGTGAACAACTGGCCATTCTCGAGAATGGCCAGTTGTTCACAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000328935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130454.1-590s21c1
Sequence:CCGGGACTTCCGTCCTGACTATTTGCTCGAGCAAATAGTCAGGACGGAAGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000328866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130454.1-1168s21c1
Sequence:CCGGCCGCCTGTATTACTCTAGGAACTCGAGTTCCTAGAGTAATACAGGCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000328867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130454.1-3160s21c1
Sequence:CCGGTCAGACCACCCTCCCATTTAACTCGAGTTAAATGGGAGGGTGGTCTGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000328868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130454.1-2840s21c1
Sequence:CCGGTACAAGGAGGGCAGGTTTATACTCGAGTATAAACCTGCCCTCCTTGTATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???