EMAIL THIS PAGE TO A FRIEND

REEP2

receptor accessory protein 2

78 Gene Product Result for
Synonyms: C5orf19 SGC32445
UniProtKB ID: Q9BRK0, Q53EM8, Q9NYF2
Gene ID:
Human(51308) Summary: This gene encodes a member of the receptor expression enhancing protein family. Studies of a related gene in mouse suggest that the encoded protein is found in the cell membrane and enhances the function of sweet taste receptors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Mouse(225362) receptor accessory protein 2
Rat(682105) receptor accessory protein 2
naked mole-rat(101714246) receptor accessory protein 2
domestic guinea pig(100715174) receptor accessory protein 2
cow(532432) receptor accessory protein 2
sheep(101111544) receptor accessory protein 2
Zebrafish(568927) receptor accessory protein 2
chicken(771891) receptor accessory protein 2
domestic cat(101088137) receptor accessory protein 2
dog(100683708) receptor accessory protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1407478 Anti-C5ORF19 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1101768 Anti-REEP2 (101-115) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1101769 Anti-REEP2 (207-220) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
HPA031813 Anti-REEP2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry, western blot pricing
SAB3500149 Anti-REEP2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5202022 Monoclonal Anti-REEP1/2 antibody produced in mouse clone S326D-29 rat, human
immunofluorescence, western blot pricing
SAB5202031 Monoclonal Anti-REEP1/2-Alkaline Phosphatase antibody produced in mouse clone S326D-29 rat, human
immunofluorescence, western blot pricing
SAB5202032 Monoclonal Anti-REEP1/2-Allophycocyanin antibody produced in mouse clone S326D-29 rat, human
immunofluorescence, western blot pricing
SAB5202023 Monoclonal Anti-REEP1/2-Atto 390 antibody produced in mouse clone S326D-29 human, rat
immunofluorescence, western blot pricing
SAB5202024 Monoclonal Anti-REEP1/2-Atto 488 antibody produced in mouse clone S326D-29 rat, human
immunofluorescence, western blot pricing
SAB5202026 Monoclonal Anti-REEP1/2-Atto 594 antibody produced in mouse clone S326D-29 rat, human
immunofluorescence, western blot pricing
SAB5202025 Monoclonal Anti-REEP1/2-Atto 595 antibody produced in mouse clone S326D-29 human, rat
immunofluorescence, western blot pricing
SAB5202027 Monoclonal Anti-REEP1/2-Atto 633 antibody produced in mouse clone S326D-29 human, rat
immunofluorescence, western blot pricing
SAB5202028 Monoclonal Anti-REEP1/2-Atto 655 antibody produced in mouse clone S326D-29 rat, human
immunofluorescence, western blot pricing
SAB5202029 Monoclonal Anti-REEP1/2-Atto 680 antibody produced in mouse clone S326D-29 human, rat
immunofluorescence, western blot pricing
SAB5202030 Monoclonal Anti-REEP1/2-Atto 700 antibody produced in mouse clone S326D-29 human, rat
immunofluorescence, western blot pricing
SAB5202033 Monoclonal Anti-REEP1/2-Biotin antibody produced in mouse clone S326D-29 rat, human
immunofluorescence, western blot pricing
SAB5202034 Monoclonal Anti-REEP1/2-FITC antibody produced in mouse clone S326D-29 rat, human
immunofluorescence, western blot pricing
SAB5202035 Monoclonal Anti-REEP1/2-Horseradish Peroxidase antibody produced in mouse clone S326D-29 human, rat
immunofluorescence, western blot pricing
SAB5202036 Monoclonal Anti-REEP1/2-PE/Atto 594 antibody produced in mouse clone S326D-29 human, rat
immunofluorescence, western blot pricing
SAB5202037 Monoclonal Anti-REEP1/2-PerCP antibody produced in mouse clone S326D-29 human, rat
immunofluorescence, western blot pricing
SAB5202038 Monoclonal Anti-REEP1/2-R-Phycoerythrin antibody produced in mouse clone S326D-29 human, rat
immunofluorescence, western blot pricing
SAB5202039 Monoclonal Anti-REEP1/2-Streptavidin antibody produced in mouse clone S326D-29 rat, human
immunofluorescence, western blot pricing
SAB5202004 Monoclonal Anti-REEP2 antibody produced in mouse clone S326D-2 African green monkey, human
immunofluorescence, western blot pricing
SAB5202013 Monoclonal Anti-REEP2-Alkaline Phosphatase antibody produced in mouse clone S326D-2 human, African green monkey
immunofluorescence, western blot pricing
SAB5202014 Monoclonal Anti-REEP2-Allophycocyanin antibody produced in mouse clone S326D-2 African green monkey, human
immunofluorescence, western blot pricing
SAB5202005 Monoclonal Anti-REEP2-Atto 390 antibody produced in mouse clone S326D-2 African green monkey, human
immunofluorescence, western blot pricing
SAB5202006 Monoclonal Anti-REEP2-Atto 488 antibody produced in mouse clone S326D-2 human, African green monkey
immunofluorescence, western blot pricing
SAB5202008 Monoclonal Anti-REEP2-Atto 594 antibody produced in mouse clone S326D-2 human, African green monkey
immunofluorescence, western blot pricing
SAB5202007 Monoclonal Anti-REEP2-Atto 595 antibody produced in mouse clone S326D-2 African green monkey, human
immunofluorescence, western blot pricing
SAB5202009 Monoclonal Anti-REEP2-Atto 633 antibody produced in mouse clone S326D-2 human, African green monkey
immunofluorescence, western blot pricing
SAB5202010 Monoclonal Anti-REEP2-Atto 655 antibody produced in mouse clone S326D-2 human, African green monkey
immunofluorescence, western blot pricing
SAB5202011 Monoclonal Anti-REEP2-Atto 680 antibody produced in mouse clone S326D-2 African green monkey, human
immunofluorescence, western blot pricing
SAB5202012 Monoclonal Anti-REEP2-Atto 700 antibody produced in mouse clone S326D-2 human, African green monkey
immunofluorescence, western blot pricing
SAB5202015 Monoclonal Anti-REEP2-Biotin antibody produced in mouse clone S326D-2 African green monkey, human
immunofluorescence, western blot pricing
SAB5202016 Monoclonal Anti-REEP2-FITC antibody produced in mouse clone S326D-2 human, African green monkey
immunofluorescence, western blot pricing
SAB5202017 Monoclonal Anti-REEP2-Horseradish Peroxidase antibody produced in mouse clone S326D-2 African green monkey, human
immunofluorescence, western blot pricing
SAB5202018 Monoclonal Anti-REEP2-PE/Atto 594 antibody produced in mouse clone S326D-2 human, African green monkey
immunofluorescence, western blot pricing
SAB5202019 Monoclonal Anti-REEP2-PerCP antibody produced in mouse clone S326D-2 human, African green monkey
immunofluorescence, western blot pricing
SAB5202020 Monoclonal Anti-REEP2-R-Phycoerythrin antibody produced in mouse clone S326D-2 African green monkey, human
immunofluorescence, western blot pricing
SAB5202021 Monoclonal Anti-REEP2-Streptavidin antibody produced in mouse clone S326D-2 human, African green monkey
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016606 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016606 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016606 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144865 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144865 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144865 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016606 Rosetta Predictions human pricing
NM_001048047 Rosetta Predictions rat pricing
NM_144865 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016606 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011768 predicted 690
2 SASI_Hs01_00011769 predicted 896
3 SASI_Hs01_00011770 predicted 492
4 SASI_Hs01_00011771 predicted 1183
5 SASI_Hs01_00011772 predicted 662
6 SASI_Hs01_00011774 predicted 507
7 SASI_Hs01_00011775 predicted 390
8 SASI_Hs01_00011776 predicted 1213
9 SASI_Hs02_00349743 predicted 670
10 SASI_Hs01_00011777 predicted 449
11 SASI_Hs01_00011773 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001048047 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207364 predicted 267
2 SASI_Rn02_00207365 predicted 766
3 SASI_Rn02_00207366 predicted 1169
4 SASI_Rn02_00207367 predicted 689
5 SASI_Rn02_00207368 predicted 781
6 SASI_Rn02_00207369 predicted 1161
7 SASI_Rn02_00207370 predicted 660
8 SASI_Rn02_00207371 predicted 951
9 SASI_Rn02_00207372 predicted 567
10 SASI_Rn02_00207373 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144865 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130377 predicted 397
2 SASI_Mm01_00130378 predicted 243
3 SASI_Mm02_00340293 predicted 745
4 SASI_Mm01_00130380 predicted 802
5 SASI_Mm01_00130381 predicted 645
6 SASI_Mm01_00130382 predicted 669
7 SASI_Mm01_00130383 predicted 546
8 SASI_Mm01_00130384 predicted 343
9 SASI_Mm01_00130385 predicted 1132
10 SASI_Mm01_00130386 predicted 424
11 SASI_Mm01_00130379 predicted 728
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016606
VALIDATED
REEP2 MISSION shRNA Bacterial Glycerol Stock
receptor accessory protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_016606.2-317s1c1
Sequence:CCGGCTTTGAACTGAAGATCGCCTTCTCGAGAAGGCGATCTTCAGTTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016606.2-458s1c1
Sequence:CCGGCAAGAGCTATGAGACCATGATCTCGAGATCATGGTCTCATAGCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016606.2-815s1c1
Sequence:CCGGACTGGCTTCCAAGACACTGAACTCGAGTTCAGTGTCTTGGAAGCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016606.2-698s1c1
Sequence:CCGGGAGTCTAAGGTCCAGCACAAACTCGAGTTTGTGCTGGACCTTAGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016606.2-176s1c1
Sequence:CCGGCCCAGCCTATTCTTCCTACAACTCGAGTTGTAGGAAGAATAGGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016606.2-328s21c1
Sequence:CCGGAGATCGCCTTCGTGATATGGCCTCGAGGCCATATCACGAAGGCGATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016606.2-1202s21c1
Sequence:CCGGAGCCCATAGCAATCCGCTTCTCTCGAGAGAAGCGGATTGCTATGGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016606.2-190s21c1
Sequence:CCGGCCTACAAGGCCGTGAAGACAACTCGAGTTGTCTTCACGGCCTTGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016606.2-403s21c1
Sequence:CCGGCAACGCTGTCCAACAAGGAGACTCGAGTCTCCTTGTTGGACAGCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016606
VALIDATED
REEP2 MISSION shRNA shRNA Plasmid DNA
receptor accessory protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_016606.2-317s1c1
Sequence:CCGGCTTTGAACTGAAGATCGCCTTCTCGAGAAGGCGATCTTCAGTTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016606.2-458s1c1
Sequence:CCGGCAAGAGCTATGAGACCATGATCTCGAGATCATGGTCTCATAGCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016606.2-815s1c1
Sequence:CCGGACTGGCTTCCAAGACACTGAACTCGAGTTCAGTGTCTTGGAAGCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016606.2-698s1c1
Sequence:CCGGGAGTCTAAGGTCCAGCACAAACTCGAGTTTGTGCTGGACCTTAGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016606.2-176s1c1
Sequence:CCGGCCCAGCCTATTCTTCCTACAACTCGAGTTGTAGGAAGAATAGGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016606.2-328s21c1
Sequence:CCGGAGATCGCCTTCGTGATATGGCCTCGAGGCCATATCACGAAGGCGATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016606.2-1202s21c1
Sequence:CCGGAGCCCATAGCAATCCGCTTCTCTCGAGAGAAGCGGATTGCTATGGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016606.2-190s21c1
Sequence:CCGGCCTACAAGGCCGTGAAGACAACTCGAGTTGTCTTCACGGCCTTGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016606.2-403s21c1
Sequence:CCGGCAACGCTGTCCAACAAGGAGACTCGAGTCTCCTTGTTGGACAGCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016606
VALIDATED
REEP2 MISSION shRNA Lentiviral Transduction Particles
receptor accessory protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A3
TRC Version: 1 Clone ID:NM_016606.2-317s1c1
Sequence:CCGGCTTTGAACTGAAGATCGCCTTCTCGAGAAGGCGATCTTCAGTTCAAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016606.2-458s1c1
Sequence:CCGGCAAGAGCTATGAGACCATGATCTCGAGATCATGGTCTCATAGCTCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016606.2-815s1c1
Sequence:CCGGACTGGCTTCCAAGACACTGAACTCGAGTTCAGTGTCTTGGAAGCCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016606.2-698s1c1
Sequence:CCGGGAGTCTAAGGTCCAGCACAAACTCGAGTTTGTGCTGGACCTTAGACTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016606.2-176s1c1
Sequence:CCGGCCCAGCCTATTCTTCCTACAACTCGAGTTGTAGGAAGAATAGGCTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016606.2-328s21c1
Sequence:CCGGAGATCGCCTTCGTGATATGGCCTCGAGGCCATATCACGAAGGCGATCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016606.2-1202s21c1
Sequence:CCGGAGCCCATAGCAATCCGCTTCTCTCGAGAGAAGCGGATTGCTATGGGCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016606.2-190s21c1
Sequence:CCGGCCTACAAGGCCGTGAAGACAACTCGAGTTGTCTTCACGGCCTTGTAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016606.2-403s21c1
Sequence:CCGGCAACGCTGTCCAACAAGGAGACTCGAGTCTCCTTGTTGGACAGCGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144865
REEP2 MISSION shRNA Bacterial Glycerol Stock
receptor accessory protein 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000194531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144865.1-1422s1c1
Sequence:CCGGGCTCTGGTCTTTCTTCCTCTTCTCGAGAAGAGGAAGAAAGACCAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144865.1-825s1c1
Sequence:CCGGCCCAAGAAGAAGAGTTCTGGACTCGAGTCCAGAACTCTTCTTCTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144865.1-953s1c1
Sequence:CCGGCAAGTGTTTCAGACCCGCAAACTCGAGTTTGCGGGTCTGAAACACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144865.1-300s1c1
Sequence:CCGGCTCAAGATTGCCTTTGTGATACTCGAGTATCACAAAGGCAATCTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144865
REEP2 MISSION shRNA shRNA Plasmid DNA
receptor accessory protein 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000194531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144865.1-1422s1c1
Sequence:CCGGGCTCTGGTCTTTCTTCCTCTTCTCGAGAAGAGGAAGAAAGACCAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144865.1-825s1c1
Sequence:CCGGCCCAAGAAGAAGAGTTCTGGACTCGAGTCCAGAACTCTTCTTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144865.1-953s1c1
Sequence:CCGGCAAGTGTTTCAGACCCGCAAACTCGAGTTTGCGGGTCTGAAACACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144865.1-300s1c1
Sequence:CCGGCTCAAGATTGCCTTTGTGATACTCGAGTATCACAAAGGCAATCTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144865
REEP2 MISSION shRNA Lentiviral Transduction Particles
receptor accessory protein 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000194531    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144865.1-1422s1c1
Sequence:CCGGGCTCTGGTCTTTCTTCCTCTTCTCGAGAAGAGGAAGAAAGACCAGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144865.1-825s1c1
Sequence:CCGGCCCAAGAAGAAGAGTTCTGGACTCGAGTCCAGAACTCTTCTTCTTGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173261    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144865.1-953s1c1
Sequence:CCGGCAAGTGTTTCAGACCCGCAAACTCGAGTTTGCGGGTCTGAAACACTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144865.1-300s1c1
Sequence:CCGGCTCAAGATTGCCTTTGTGATACTCGAGTATCACAAAGGCAATCTTGAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)