EMAIL THIS PAGE TO A FRIEND

REEP4

receptor accessory protein 4

49 Gene Product Result for
Synonyms: C8orf20
UniProtKB ID: Q9H6H4, D3DSQ9, Q86VL1, Q9H6I5, Q9HBP4
Gene ID:
Mouse(72549) receptor accessory protein 4
Rat(306014) receptor accessory protein 4
dog(486129) receptor accessory protein 4
domestic cat(101093599) receptor accessory protein 4
domestic guinea pig(100728197) receptor accessory protein 4
naked mole-rat(101712601) receptor accessory protein 4
cow(519613) receptor accessory protein 4
sheep(101116960) receptor accessory protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_180588 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_180588 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_180588 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_025232 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025232 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025232 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025232 Rosetta Predictions human pricing
NM_001025279 Rosetta Predictions rat pricing
NM_180588 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025232 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120262 predicted 762
2 SASI_Hs01_00120263 predicted 600
3 SASI_Hs01_00120264 predicted 1218
4 SASI_Hs01_00120265 predicted 1043
5 SASI_Hs01_00120266 predicted 594
6 SASI_Hs01_00120267 predicted 529
7 SASI_Hs01_00120268 predicted 1338
8 SASI_Hs01_00120269 predicted 544
9 SASI_Hs01_00120270 predicted 545
10 SASI_Hs01_00120271 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025279 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086081 predicted 483
2 SASI_Rn01_00086082 predicted 763
3 SASI_Rn01_00086083 predicted 606
4 SASI_Rn01_00086084 predicted 809
5 SASI_Rn01_00086085 predicted 266
6 SASI_Rn02_00203106 predicted 365
7 SASI_Rn01_00086086 predicted 322
8 SASI_Rn01_00086087 predicted 704
9 SASI_Rn01_00086089 predicted 857
10 SASI_Rn02_00203107 predicted 786
11 SASI_Rn01_00086088 predicted 702
12 SASI_Rn01_00086090 predicted 290
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_180588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121251 predicted 408
2 SASI_Mm01_00121252 predicted 228
3 SASI_Mm01_00121253 predicted 395
4 SASI_Mm01_00121254 predicted 868
5 SASI_Mm01_00121255 predicted 251
6 SASI_Mm02_00349577 predicted 476
7 SASI_Mm01_00121256 predicted 834
8 SASI_Mm01_00121257 predicted 421
9 SASI_Mm01_00121258 predicted 772
10 SASI_Mm01_00121260 predicted 515
11 SASI_Mm01_00121259 predicted 768
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_180588
REEP4 MISSION shRNA Bacterial Glycerol Stock
receptor accessory protein 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_180588.1-979s1c1
Sequence:CCGGGCACAGGGAGACATTCACTATCTCGAGATAGTGAATGTCTCCCTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180588.1-193s1c1
Sequence:CCGGCGGTGGATGATGTATTGGATTCTCGAGAATCCAATACATCATCCACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180588.1-210s1c1
Sequence:CCGGGATTGTCTTTGCGATCTTCATCTCGAGATGAAGATCGCAAAGACAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180588.1-422s1c1
Sequence:CCGGGCAGCTATGAAACCATGCTCACTCGAGTGAGCATGGTTTCATAGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180588.1-425s1c1
Sequence:CCGGGCTATGAAACCATGCTCAGTTCTCGAGAACTGAGCATGGTTTCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_180588
REEP4 MISSION shRNA shRNA Plasmid DNA
receptor accessory protein 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_180588.1-979s1c1
Sequence:CCGGGCACAGGGAGACATTCACTATCTCGAGATAGTGAATGTCTCCCTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180588.1-193s1c1
Sequence:CCGGCGGTGGATGATGTATTGGATTCTCGAGAATCCAATACATCATCCACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180588.1-210s1c1
Sequence:CCGGGATTGTCTTTGCGATCTTCATCTCGAGATGAAGATCGCAAAGACAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180588.1-422s1c1
Sequence:CCGGGCAGCTATGAAACCATGCTCACTCGAGTGAGCATGGTTTCATAGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180588.1-425s1c1
Sequence:CCGGGCTATGAAACCATGCTCAGTTCTCGAGAACTGAGCATGGTTTCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_180588
REEP4 MISSION shRNA Lentiviral Transduction Particles
receptor accessory protein 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194492    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_180588.1-979s1c1
Sequence:CCGGGCACAGGGAGACATTCACTATCTCGAGATAGTGAATGTCTCCCTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180588.1-193s1c1
Sequence:CCGGCGGTGGATGATGTATTGGATTCTCGAGAATCCAATACATCATCCACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180588.1-210s1c1
Sequence:CCGGGATTGTCTTTGCGATCTTCATCTCGAGATGAAGATCGCAAAGACAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180588.1-422s1c1
Sequence:CCGGGCAGCTATGAAACCATGCTCACTCGAGTGAGCATGGTTTCATAGCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_180588.1-425s1c1
Sequence:CCGGGCTATGAAACCATGCTCAGTTCTCGAGAACTGAGCATGGTTTCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025232
VALIDATED
REEP4 MISSION shRNA Bacterial Glycerol Stock
receptor accessory protein 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025232.2-604s1c1
Sequence:CCGGGCAGAGATCGTTACAGACATTCTCGAGAATGTCTGTAACGATCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025232.2-639s1c1
Sequence:CCGGCCCTTTCTACTATGAGATCAACTCGAGTTGATCTCATAGTAGAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_025232.2-706s1c1
Sequence:CCGGAGCCTGCTTTACCGCAAGTTTCTCGAGAAACTTGCGGTAAAGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_025232.2-1176s1c1
Sequence:CCGGCCTGAAGGTTCGGACGAGGAACTCGAGTTCCTCGTCCGAACCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025232.2-537s1c1
Sequence:CCGGGACCAAGAACATTCGTGAATACTCGAGTATTCACGAATGTTCTTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025232.2-604s1c2
Sequence:CCGGGCAGAGATCGTTACAGACATTCTCGAGAATGTCTGTAACGATCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025232.2-1345s21c1
Sequence:CCGGTGACTCCTGCTGATGGTTAAGCTCGAGCTTAACCATCAGCAGGAGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025232.2-1046s21c1
Sequence:CCGGATGAGTGTTGGTCAGATACTGCTCGAGCAGTATCTGACCAACACTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025232.2-507s21c1
Sequence:CCGGTCCAGCTTATGCTTCCTATAACTCGAGTTATAGGAAGCATAAGCTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025232
VALIDATED
REEP4 MISSION shRNA shRNA Plasmid DNA
receptor accessory protein 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025232.2-604s1c1
Sequence:CCGGGCAGAGATCGTTACAGACATTCTCGAGAATGTCTGTAACGATCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025232.2-639s1c1
Sequence:CCGGCCCTTTCTACTATGAGATCAACTCGAGTTGATCTCATAGTAGAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_025232.2-706s1c1
Sequence:CCGGAGCCTGCTTTACCGCAAGTTTCTCGAGAAACTTGCGGTAAAGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_025232.2-1176s1c1
Sequence:CCGGCCTGAAGGTTCGGACGAGGAACTCGAGTTCCTCGTCCGAACCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000063390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025232.2-537s1c1
Sequence:CCGGGACCAAGAACATTCGTGAATACTCGAGTATTCACGAATGTTCTTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025232.2-604s1c2
Sequence:CCGGGCAGAGATCGTTACAGACATTCTCGAGAATGTCTGTAACGATCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025232.2-1345s21c1
Sequence:CCGGTGACTCCTGCTGATGGTTAAGCTCGAGCTTAACCATCAGCAGGAGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025232.2-1046s21c1
Sequence:CCGGATGAGTGTTGGTCAGATACTGCTCGAGCAGTATCTGACCAACACTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025232.2-507s21c1
Sequence:CCGGTCCAGCTTATGCTTCCTATAACTCGAGTTATAGGAAGCATAAGCTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025232
VALIDATED
REEP4 MISSION shRNA Lentiviral Transduction Particles
receptor accessory protein 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025232.2-604s1c1
Sequence:CCGGGCAGAGATCGTTACAGACATTCTCGAGAATGTCTGTAACGATCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025232.2-639s1c1
Sequence:CCGGCCCTTTCTACTATGAGATCAACTCGAGTTGATCTCATAGTAGAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_025232.2-706s1c1
Sequence:CCGGAGCCTGCTTTACCGCAAGTTTCTCGAGAAACTTGCGGTAAAGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_025232.2-1176s1c1
Sequence:CCGGCCTGAAGGTTCGGACGAGGAACTCGAGTTCCTCGTCCGAACCTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000063390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025232.2-537s1c1
Sequence:CCGGGACCAAGAACATTCGTGAATACTCGAGTATTCACGAATGTTCTTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025232.2-604s1c2
Sequence:CCGGGCAGAGATCGTTACAGACATTCTCGAGAATGTCTGTAACGATCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428004    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025232.2-1345s21c1
Sequence:CCGGTGACTCCTGCTGATGGTTAAGCTCGAGCTTAACCATCAGCAGGAGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025232.2-1046s21c1
Sequence:CCGGATGAGTGTTGGTCAGATACTGCTCGAGCAGTATCTGACCAACACTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418038    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025232.2-507s21c1
Sequence:CCGGTCCAGCTTATGCTTCCTATAACTCGAGTTATAGGAAGCATAAGCTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)