EMAIL THIS PAGE TO A FRIEND

REEP5

receptor accessory protein 5

72 Gene Product Result for
Synonyms: C5orf18 D5S346 DP1 TB2 YOP1
UniProtKB ID: Q00765, D3DT04, Q04198, Q5QGT0, Q9BWH9
Gene ID:
Mouse(13476) receptor accessory protein 5
Rat(364838) receptor accessory protein 5
cow(617543) receptor accessory protein 5
domestic guinea pig(100712705) receptor accessory protein 5
Zebrafish(337237) receptor accessory protein 5
dog(479137) receptor accessory protein 5
domestic cat(101097128) receptor accessory protein 5
chicken(770021) receptor accessory protein 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007874 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007874 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007874 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005669 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005669 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005669 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005669 Rosetta Predictions human pricing
NM_001108888 Rosetta Predictions rat pricing
NM_007874 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005669 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172173 predicted 399
2 SASI_Hs02_00340051 predicted 634
3 SASI_Hs01_00172175 predicted 719
4 SASI_Hs01_00172177 predicted 758
5 SASI_Hs02_00340052 predicted 307
6 SASI_Hs02_00340053 predicted 227
7 SASI_Hs01_00172181 predicted 597
8 SASI_Hs01_00172182 predicted 355
9 SASI_Hs02_00340054 predicted 639
10 SASI_Hs02_00340055 predicted 604
11 SASI_Hs01_00172174 predicted 560
12 SASI_Hs01_00172176 predicted 540
13 SASI_Hs01_00172178 predicted 548
14 SASI_Hs01_00172179 predicted 633
15 SASI_Hs01_00172180 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108888 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243075 predicted 783
2 SASI_Rn02_00243076 predicted 763
3 SASI_Rn02_00243077 predicted 780
4 SASI_Rn02_00243078 predicted 766
5 SASI_Rn02_00243079 predicted 874
6 SASI_Rn02_00243080 predicted 1371
7 SASI_Rn02_00243081 predicted 1086
8 SASI_Rn02_00243082 predicted 872
9 SASI_Rn02_00243083 predicted 666
10 SASI_Rn02_00243084 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007874 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074512 predicted 747
2 SASI_Mm01_00074513 predicted 729
3 SASI_Mm01_00074514 predicted 776
4 SASI_Mm01_00074515 predicted 368
5 SASI_Mm01_00074516 predicted 192
6 SASI_Mm01_00074517 predicted 626
7 SASI_Mm01_00074518 predicted 183
8 SASI_Mm01_00074519 predicted 390
9 SASI_Mm01_00074521 predicted 358
10 SASI_Mm02_00312661 predicted 1062
11 SASI_Mm01_00074520 predicted 441
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007874
VALIDATED
REEP5 MISSION shRNA Bacterial Glycerol Stock
receptor accessory protein 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007874.3-797s21c1
Sequence:CCGGTTTGCCTTTGTTGTCGTATATCTCGAGATATACGACAACAAAGGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007874.3-508s21c1
Sequence:CCGGGCGAATCATCCGTCCTATCTTCTCGAGAAGATAGGACGGATGATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007874.3-270s21c1
Sequence:CCGGGCAACCTGATAGGTTTCGGATCTCGAGATCCGAAACCTATCAGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007874.3-391s21c1
Sequence:CCGGCGAATTCTTCTCCGATCTCTTCTCGAGAAGAGATCGGAGAAGAATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007874.2-2431s1c1
Sequence:CCGGGCTGGAAACAAAGCATTTATTCTCGAGAATAAATGCTTTGTTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007874.2-322s1c1
Sequence:CCGGCGAATTCTTCTCCGATCTCTTCTCGAGAAGAGATCGGAGAAGAATTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007874.2-436s1c1
Sequence:CCGGCAGGCGAATCATCCGTCCTATCTCGAGATAGGACGGATGATTCGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007874.2-439s1c1
Sequence:CCGGGCGAATCATCCGTCCTATCTTCTCGAGAAGATAGGACGGATGATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007874.2-201s1c1
Sequence:CCGGGCAACCTGATAGGTTTCGGATCTCGAGATCCGAAACCTATCAGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007874
VALIDATED
REEP5 MISSION shRNA shRNA Plasmid DNA
receptor accessory protein 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007874.3-797s21c1
Sequence:CCGGTTTGCCTTTGTTGTCGTATATCTCGAGATATACGACAACAAAGGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007874.3-508s21c1
Sequence:CCGGGCGAATCATCCGTCCTATCTTCTCGAGAAGATAGGACGGATGATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007874.3-270s21c1
Sequence:CCGGGCAACCTGATAGGTTTCGGATCTCGAGATCCGAAACCTATCAGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000335518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007874.3-391s21c1
Sequence:CCGGCGAATTCTTCTCCGATCTCTTCTCGAGAAGAGATCGGAGAAGAATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007874.2-2431s1c1
Sequence:CCGGGCTGGAAACAAAGCATTTATTCTCGAGAATAAATGCTTTGTTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007874.2-322s1c1
Sequence:CCGGCGAATTCTTCTCCGATCTCTTCTCGAGAAGAGATCGGAGAAGAATTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007874.2-436s1c1
Sequence:CCGGCAGGCGAATCATCCGTCCTATCTCGAGATAGGACGGATGATTCGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007874.2-439s1c1
Sequence:CCGGGCGAATCATCCGTCCTATCTTCTCGAGAAGATAGGACGGATGATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007874.2-201s1c1
Sequence:CCGGGCAACCTGATAGGTTTCGGATCTCGAGATCCGAAACCTATCAGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007874
VALIDATED
REEP5 MISSION shRNA Lentiviral Transduction Particles
receptor accessory protein 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348633    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007874.3-797s21c1
Sequence:CCGGTTTGCCTTTGTTGTCGTATATCTCGAGATATACGACAACAAAGGCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007874.3-508s21c1
Sequence:CCGGGCGAATCATCCGTCCTATCTTCTCGAGAAGATAGGACGGATGATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007874.3-270s21c1
Sequence:CCGGGCAACCTGATAGGTTTCGGATCTCGAGATCCGAAACCTATCAGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000335518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007874.3-391s21c1
Sequence:CCGGCGAATTCTTCTCCGATCTCTTCTCGAGAAGAGATCGGAGAAGAATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106185    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007874.2-2431s1c1
Sequence:CCGGGCTGGAAACAAAGCATTTATTCTCGAGAATAAATGCTTTGTTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007874.2-322s1c1
Sequence:CCGGCGAATTCTTCTCCGATCTCTTCTCGAGAAGAGATCGGAGAAGAATTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007874.2-436s1c1
Sequence:CCGGCAGGCGAATCATCCGTCCTATCTCGAGATAGGACGGATGATTCGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007874.2-439s1c1
Sequence:CCGGGCGAATCATCCGTCCTATCTTCTCGAGAAGATAGGACGGATGATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007874.2-201s1c1
Sequence:CCGGGCAACCTGATAGGTTTCGGATCTCGAGATCCGAAACCTATCAGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005669
VALIDATED
REEP5 MISSION shRNA Bacterial Glycerol Stock
receptor accessory protein 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005669.4-664s21c1
Sequence:CCGGGCGAAGAAAGCTACCGTGAATCTCGAGATTCACGGTAGCTTTCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005669.4-648s21c1
Sequence:CCGGTGCCATCACTAAAGAAGCGAACTCGAGTTCGCTTCTTTAGTGATGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005669.4-343s21c1
Sequence:CCGGCCAGCCTACATCTCAATTAAACTCGAGTTTAATTGAGATGTAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005669.4-234s21c1
Sequence:CCGGCGGCGTGAACAGGAGCTTCATCTCGAGATGAAGCTCCTGTTCACGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005669.3-1259s1c1
Sequence:CCGGGCCTGGTTGTTTCCCTAGTATCTCGAGATACTAGGGAAACAACCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005669.3-224s1c1
Sequence:CCGGCCAGCCTACATCTCAATTAAACTCGAGTTTAATTGAGATGTAGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005669.3-529s1c1
Sequence:CCGGTGCCATCACTAAAGAAGCGAACTCGAGTTCGCTTCTTTAGTGATGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005669.3-115s1c1
Sequence:CCGGCGGCGTGAACAGGAGCTTCATCTCGAGATGAAGCTCCTGTTCACGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005669.3-545s1c1
Sequence:CCGGGCGAAGAAAGCTACCGTGAATCTCGAGATTCACGGTAGCTTTCTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005669
VALIDATED
REEP5 MISSION shRNA shRNA Plasmid DNA
receptor accessory protein 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005669.4-664s21c1
Sequence:CCGGGCGAAGAAAGCTACCGTGAATCTCGAGATTCACGGTAGCTTTCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005669.4-648s21c1
Sequence:CCGGTGCCATCACTAAAGAAGCGAACTCGAGTTCGCTTCTTTAGTGATGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005669.4-343s21c1
Sequence:CCGGCCAGCCTACATCTCAATTAAACTCGAGTTTAATTGAGATGTAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005669.4-234s21c1
Sequence:CCGGCGGCGTGAACAGGAGCTTCATCTCGAGATGAAGCTCCTGTTCACGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005669.3-1259s1c1
Sequence:CCGGGCCTGGTTGTTTCCCTAGTATCTCGAGATACTAGGGAAACAACCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005669.3-224s1c1
Sequence:CCGGCCAGCCTACATCTCAATTAAACTCGAGTTTAATTGAGATGTAGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005669.3-529s1c1
Sequence:CCGGTGCCATCACTAAAGAAGCGAACTCGAGTTCGCTTCTTTAGTGATGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005669.3-115s1c1
Sequence:CCGGCGGCGTGAACAGGAGCTTCATCTCGAGATGAAGCTCCTGTTCACGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005669.3-545s1c1
Sequence:CCGGGCGAAGAAAGCTACCGTGAATCTCGAGATTCACGGTAGCTTTCTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005669
VALIDATED
REEP5 MISSION shRNA Lentiviral Transduction Particles
receptor accessory protein 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005669.4-664s21c1
Sequence:CCGGGCGAAGAAAGCTACCGTGAATCTCGAGATTCACGGTAGCTTTCTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005669.4-648s21c1
Sequence:CCGGTGCCATCACTAAAGAAGCGAACTCGAGTTCGCTTCTTTAGTGATGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300827    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005669.4-343s21c1
Sequence:CCGGCCAGCCTACATCTCAATTAAACTCGAGTTTAATTGAGATGTAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005669.4-234s21c1
Sequence:CCGGCGGCGTGAACAGGAGCTTCATCTCGAGATGAAGCTCCTGTTCACGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117837    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_005669.3-1259s1c1
Sequence:CCGGGCCTGGTTGTTTCCCTAGTATCTCGAGATACTAGGGAAACAACCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117838    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005669.3-224s1c1
Sequence:CCGGCCAGCCTACATCTCAATTAAACTCGAGTTTAATTGAGATGTAGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005669.3-529s1c1
Sequence:CCGGTGCCATCACTAAAGAAGCGAACTCGAGTTCGCTTCTTTAGTGATGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005669.3-115s1c1
Sequence:CCGGCGGCGTGAACAGGAGCTTCATCTCGAGATGAAGCTCCTGTTCACGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005669.3-545s1c1
Sequence:CCGGGCGAAGAAAGCTACCGTGAATCTCGAGATTCACGGTAGCTTTCTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)