EMAIL THIS PAGE TO A FRIEND

REEP6

receptor accessory protein 6

48 Gene Product Result for
Synonyms: C19orf32 DP1L1 TB2L1
UniProtKB ID: Q96HR9, B2RE01, D6W5Z0, Q96LM0
Gene ID:
Mouse(70335) receptor accessory protein 6
Rat(362835) receptor accessory protein 6
Zebrafish(447918) receptor accessory protein 6
domestic cat(101097950) receptor accessory protein 6
chicken(427265) receptor accessory protein 6
dog(612290) receptor accessory protein 6
domestic guinea pig(100733067) receptor accessory protein 6
naked mole-rat(101697966) receptor accessory protein 6
cow(522480) receptor accessory protein 6
sheep(101118947) receptor accessory protein 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_139292 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_139292 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_139292 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_138393 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138393 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138393 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138393 Rosetta Predictions human pricing
NM_001013218 Rosetta Predictions rat pricing
NM_139292 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105853 predicted 294
2 SASI_Hs01_00105854 predicted 338
3 SASI_Hs01_00105855 predicted 376
4 SASI_Hs01_00105856 predicted 265
5 SASI_Hs01_00105857 predicted 599
6 SASI_Hs01_00105858 predicted 552
7 SASI_Hs01_00105859 predicted 259
8 SASI_Hs01_00105860 predicted 330
9 SASI_Hs01_00105861 predicted 317
10 SASI_Hs02_00363537 predicted 221
11 SASI_Hs01_00105852 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013218 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053187 predicted 215
2 SASI_Rn02_00201019 predicted 336
3 SASI_Rn01_00053189 predicted 265
4 SASI_Rn01_00053190 predicted 303
5 SASI_Rn01_00053191 predicted 512
6 SASI_Rn01_00053192 predicted 367
7 SASI_Rn01_00053193 predicted 240
8 SASI_Rn01_00053194 predicted 306
9 SASI_Rn01_00053196 predicted 142
10 SASI_Rn02_00201020 predicted 686
11 SASI_Rn01_00053188 predicted 439
12 SASI_Rn01_00053195 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139292 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00188049 predicted 549
2 SASI_Mm01_00188050 predicted 256
3 SASI_Mm01_00188051 predicted 337
4 SASI_Mm01_00188052 predicted 295
5 SASI_Mm01_00188053 predicted 330
6 SASI_Mm01_00188054 predicted 286
7 SASI_Mm01_00188055 predicted 226
8 SASI_Mm01_00188056 predicted 354
9 SASI_Mm01_00188057 predicted 470
10 SASI_Mm01_00188058 predicted 220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_139292
VALIDATED
REEP6 MISSION shRNA Bacterial Glycerol Stock
receptor accessory protein 6
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000106046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_139292.1-473s1c1
Sequence:CCGGCGCGTCATAAGACCACTCTTTCTCGAGAAAGAGTGGTCTTATGACGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_139292.1-196s1c1
Sequence:CCGGCCTGTATCTTCTGTTCGGTTACTCGAGTAACCGAACAGAAGATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_139292.1-472s1c1
Sequence:CCGGTCGCGTCATAAGACCACTCTTCTCGAGAAGAGTGGTCTTATGACGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_139292.1-230s1c1
Sequence:CCGGCTGTGCAATGTCATCGGATTTCTCGAGAAATCCGATGACATTGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_139292
VALIDATED
REEP6 MISSION shRNA shRNA Plasmid DNA
receptor accessory protein 6
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000106046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_139292.1-473s1c1
Sequence:CCGGCGCGTCATAAGACCACTCTTTCTCGAGAAAGAGTGGTCTTATGACGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_139292.1-196s1c1
Sequence:CCGGCCTGTATCTTCTGTTCGGTTACTCGAGTAACCGAACAGAAGATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_139292.1-472s1c1
Sequence:CCGGTCGCGTCATAAGACCACTCTTCTCGAGAAGAGTGGTCTTATGACGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000106049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_139292.1-230s1c1
Sequence:CCGGCTGTGCAATGTCATCGGATTTCTCGAGAAATCCGATGACATTGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_139292
VALIDATED
REEP6 MISSION shRNA Lentiviral Transduction Particles
receptor accessory protein 6
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000106046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_139292.1-473s1c1
Sequence:CCGGCGCGTCATAAGACCACTCTTTCTCGAGAAAGAGTGGTCTTATGACGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_139292.1-196s1c1
Sequence:CCGGCCTGTATCTTCTGTTCGGTTACTCGAGTAACCGAACAGAAGATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_139292.1-472s1c1
Sequence:CCGGTCGCGTCATAAGACCACTCTTCTCGAGAAGAGTGGTCTTATGACGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000106049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_139292.1-230s1c1
Sequence:CCGGCTGTGCAATGTCATCGGATTTCTCGAGAAATCCGATGACATTGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138393
VALIDATED
REEP6 MISSION shRNA Bacterial Glycerol Stock
receptor accessory protein 6
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138393.1-233s1c1
Sequence:CCGGGCTAAGCCTGTATCTGCTGTTCTCGAGAACAGCAGATACAGGCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138393.1-1163s1c1
Sequence:CCGGCGCCAGAAGGAATCGTCGAAACTCGAGTTTCGACGATTCCTTCTGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138393.1-272s1c1
Sequence:CCGGGCTGTGCAATCTCATCGGATTCTCGAGAATCCGATGAGATTGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138393.1-605s1c1
Sequence:CCGGCGGAATAACCAGGAACGTCAACTCGAGTTGACGTTCCTGGTTATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138393.1-396s1c1
Sequence:CCGGGCCGAGTTCTTCAGCGATCTACTCGAGTAGATCGCTGAAGAACTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000450774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138393.1-551s21c1
Sequence:CCGGGGCCGTAGACAGAATCATGAACTCGAGTTCATGATTCTGTCTACGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138393.1-433s21c1
Sequence:CCGGCTTTCTACTACGTGGGCAAGTCTCGAGACTTGCCCACGTAGTAGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138393.1-320s21c1
Sequence:CCGGAGCTATCGAGAGCCCAAGCAACTCGAGTTGCTTGGGCTCTCGATAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138393
VALIDATED
REEP6 MISSION shRNA shRNA Plasmid DNA
receptor accessory protein 6
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138393.1-233s1c1
Sequence:CCGGGCTAAGCCTGTATCTGCTGTTCTCGAGAACAGCAGATACAGGCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138393.1-1163s1c1
Sequence:CCGGCGCCAGAAGGAATCGTCGAAACTCGAGTTTCGACGATTCCTTCTGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138393.1-272s1c1
Sequence:CCGGGCTGTGCAATCTCATCGGATTCTCGAGAATCCGATGAGATTGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138393.1-605s1c1
Sequence:CCGGCGGAATAACCAGGAACGTCAACTCGAGTTGACGTTCCTGGTTATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138393.1-396s1c1
Sequence:CCGGGCCGAGTTCTTCAGCGATCTACTCGAGTAGATCGCTGAAGAACTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000450774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138393.1-551s21c1
Sequence:CCGGGGCCGTAGACAGAATCATGAACTCGAGTTCATGATTCTGTCTACGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138393.1-433s21c1
Sequence:CCGGCTTTCTACTACGTGGGCAAGTCTCGAGACTTGCCCACGTAGTAGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138393.1-320s21c1
Sequence:CCGGAGCTATCGAGAGCCCAAGCAACTCGAGTTGCTTGGGCTCTCGATAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138393
VALIDATED
REEP6 MISSION shRNA Lentiviral Transduction Particles
receptor accessory protein 6
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138393.1-233s1c1
Sequence:CCGGGCTAAGCCTGTATCTGCTGTTCTCGAGAACAGCAGATACAGGCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060543    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138393.1-1163s1c1
Sequence:CCGGCGCCAGAAGGAATCGTCGAAACTCGAGTTTCGACGATTCCTTCTGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138393.1-272s1c1
Sequence:CCGGGCTGTGCAATCTCATCGGATTCTCGAGAATCCGATGAGATTGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138393.1-605s1c1
Sequence:CCGGCGGAATAACCAGGAACGTCAACTCGAGTTGACGTTCCTGGTTATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_138393.1-396s1c1
Sequence:CCGGGCCGAGTTCTTCAGCGATCTACTCGAGTAGATCGCTGAAGAACTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000450774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138393.1-551s21c1
Sequence:CCGGGGCCGTAGACAGAATCATGAACTCGAGTTCATGATTCTGTCTACGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449680    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138393.1-433s21c1
Sequence:CCGGCTTTCTACTACGTGGGCAAGTCTCGAGACTTGCCCACGTAGTAGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138393.1-320s21c1
Sequence:CCGGAGCTATCGAGAGCCCAAGCAACTCGAGTTGCTTGGGCTCTCGATAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)