EMAIL THIS PAGE TO A FRIEND

REG1A

regenerating islet-derived 1 alpha

40 Gene Product Result for
Synonyms: ICRF P19 PSP PSPS PSPS1 PTP REG
UniProtKB ID: P05451, P11379, Q4ZG28
Gene ID:
Human(5967) Summary: This gene is a type I subclass member of the Reg gene family. The Reg gene family is a multigene family grouped into four subclasses, types I, II, III and IV, based on the primary structures of the encoded proteins. This gene encodes a protein that is secreted by the exocrine pancreas. It is associated with islet cell regeneration and diabetogenesis and may be involved in pancreatic lithogenesis. Reg family members REG1B, REGL, PAP and this gene are tandemly clustered on chromosome 2p12 and may have arisen from the same ancestral gene by gene duplication. [provided by RefSeq, Jul 2008]
Rat(24714) regenerating islet-derived 1 alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002909 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002909 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002909 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU106281 MISSION® esiRNA esiRNA human REG1A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002909 Rosetta Predictions human pricing
NM_012641 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002909 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012494 predicted 540
2 SASI_Hs01_00012495 predicted 520
3 SASI_Hs01_00012496 predicted 544
4 SASI_Hs01_00012497 predicted 508
5 SASI_Hs01_00012498 predicted 662
6 SASI_Hs01_00012499 predicted 720
7 SASI_Hs01_00012500 predicted 162
8 SASI_Hs01_00012501 predicted 708
9 SASI_Hs01_00012502 predicted 663
10 SASI_Hs01_00012503 predicted 713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012641 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109574 predicted 211
2 SASI_Rn01_00109575 predicted 283
3 SASI_Rn01_00109576 predicted 308
4 SASI_Rn01_00109577 predicted 538
5 SASI_Rn01_00109578 predicted 524
6 SASI_Rn02_00259879 predicted 505
7 SASI_Rn01_00109579 predicted 477
8 SASI_Rn01_00109581 predicted 325
9 SASI_Rn01_00109582 predicted 210
10 SASI_Rn02_00259880 predicted 467
11 SASI_Rn01_00109580 predicted 470
12 SASI_Rn01_00109583 predicted 516
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002909
REG1A MISSION shRNA Bacterial Glycerol Stock
regenerating islet-derived 1 alpha
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002909.3-520s1c1
Sequence:CCGGCCTGACCTCAAGCACAGGATTCTCGAGAATCCTGTGCTTGAGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002909.3-374s1c1
Sequence:CCGGAGTGGCACTGATGACTTCAATCTCGAGATTGAAGTCATCAGTGCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002909.3-558s1c1
Sequence:CCGGTGCCTTGTGAAGACAAGTTCTCTCGAGAGAACTTGTCTTCACAAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002909.3-233s1c1
Sequence:CCGGCGCTCCTACTGCTACTACTTTCTCGAGAAAGTAGTAGCAGTAGGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002909.3-548s1c1
Sequence:CCGGTGGAAGGATGTGCCTTGTGAACTCGAGTTCACAAGGCACATCCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002909.4-629s21c1
Sequence:CCGGGAACTGATCCAGCAATTACAACTCGAGTTGTAATTGCTGGATCAGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002909.4-497s21c1
Sequence:CCGGGTTAATCCTGGCTACTGTGTGCTCGAGCACACAGTAGCCAGGATTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002909.4-170s21c1
Sequence:CCGGCAAGAGGCCCAGACAGAGTTGCTCGAGCAACTCTGTCTGGGCCTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002909
REG1A MISSION shRNA shRNA Plasmid DNA
regenerating islet-derived 1 alpha
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002909.3-520s1c1
Sequence:CCGGCCTGACCTCAAGCACAGGATTCTCGAGAATCCTGTGCTTGAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002909.3-374s1c1
Sequence:CCGGAGTGGCACTGATGACTTCAATCTCGAGATTGAAGTCATCAGTGCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002909.3-558s1c1
Sequence:CCGGTGCCTTGTGAAGACAAGTTCTCTCGAGAGAACTTGTCTTCACAAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002909.3-233s1c1
Sequence:CCGGCGCTCCTACTGCTACTACTTTCTCGAGAAAGTAGTAGCAGTAGGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002909.3-548s1c1
Sequence:CCGGTGGAAGGATGTGCCTTGTGAACTCGAGTTCACAAGGCACATCCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002909.4-629s21c1
Sequence:CCGGGAACTGATCCAGCAATTACAACTCGAGTTGTAATTGCTGGATCAGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002909.4-497s21c1
Sequence:CCGGGTTAATCCTGGCTACTGTGTGCTCGAGCACACAGTAGCCAGGATTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002909.4-170s21c1
Sequence:CCGGCAAGAGGCCCAGACAGAGTTGCTCGAGCAACTCTGTCTGGGCCTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002909
REG1A MISSION shRNA Lentiviral Transduction Particles
regenerating islet-derived 1 alpha
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002909.3-520s1c1
Sequence:CCGGCCTGACCTCAAGCACAGGATTCTCGAGAATCCTGTGCTTGAGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002909.3-374s1c1
Sequence:CCGGAGTGGCACTGATGACTTCAATCTCGAGATTGAAGTCATCAGTGCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002909.3-558s1c1
Sequence:CCGGTGCCTTGTGAAGACAAGTTCTCTCGAGAGAACTTGTCTTCACAAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002909.3-233s1c1
Sequence:CCGGCGCTCCTACTGCTACTACTTTCTCGAGAAAGTAGTAGCAGTAGGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002909.3-548s1c1
Sequence:CCGGTGGAAGGATGTGCCTTGTGAACTCGAGTTCACAAGGCACATCCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002909.4-629s21c1
Sequence:CCGGGAACTGATCCAGCAATTACAACTCGAGTTGTAATTGCTGGATCAGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002909.4-497s21c1
Sequence:CCGGGTTAATCCTGGCTACTGTGTGCTCGAGCACACAGTAGCCAGGATTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002909.4-170s21c1
Sequence:CCGGCAAGAGGCCCAGACAGAGTTGCTCGAGCAACTCTGTCTGGGCCTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)