EMAIL THIS PAGE TO A FRIEND

REG1B

regenerating islet-derived 1 beta

18 Gene Product Result for
Synonyms: PSPS2 REGH REGI-BETA REGL
Species: Human REG1B(5968)
UniProtKB ID: P48304
Gene ID:
Human(5968) Summary: This gene is a type I subclass member of the Reg gene family. The Reg gene family is a multigene family grouped into four subclasses, types I, II, III and IV based on the primary structures of the encoded proteins. This gene encodes a protein secreted by the exocrine pancreas that is highly similar to the REG1A protein. The related REG1A protein is associated with islet cell regeneration and diabetogenesis, and may be involved in pancreatic lithogenesis. Reg family members REG1A, REGL, PAP and this gene are tandemly clustered on chromosome 2p12 and may have arisen from the same ancestral gene by gene duplication. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1659 Human Reg1B ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006507 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU126971 MISSION® esiRNA esiRNA human REG1B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006507 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166818 predicted 498
2 SASI_Hs01_00166820 predicted 538
3 SASI_Hs01_00166821 predicted 476
4 SASI_Hs01_00166822 predicted 501
5 SASI_Hs01_00166819 predicted 525
6 SASI_Hs01_00166823 predicted 751
7 SASI_Hs01_00166824 predicted 113
8 SASI_Hs01_00166825 predicted 110
9 SASI_Hs01_00166826 predicted 696
10 SASI_Hs01_00166827 predicted 107
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006507
REG1B MISSION shRNA Bacterial Glycerol Stock
regenerating islet-derived 1 beta
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006507.3-504s21c1
Sequence:CCGGGTGCTAATGCTGGCTACTGTGCTCGAGCACAGTAGCCAGCATTAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006507.3-629s21c1
Sequence:CCGGGGATGTCTAGAACTGGTCCTGCTCGAGCAGGACCAGTTCTAGACATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006507.2-498s1c1
Sequence:CCGGCCTGACTTCATGCTCAGGATTCTCGAGAATCCTGAGCATGAAGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006507.2-152s1c1
Sequence:CCGGAGTCCCAGACAGAGCTGCCTACTCGAGTAGGCAGCTCTGTCTGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006507.2-273s1c1
Sequence:CCGGCCAGAACATGAATTCAGGCAACTCGAGTTGCCTGAATTCATGTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006507.2-335s1c1
Sequence:CCGGCCTCACTGATTAAGGAGAGTACTCGAGTACTCTCCTTAATCAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006507.2-506s1c1
Sequence:CCGGCATGCTCAGGATTCAAGAAATCTCGAGATTTCTTGAATCCTGAGCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006507
REG1B MISSION shRNA shRNA Plasmid DNA
regenerating islet-derived 1 beta
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006507.3-504s21c1
Sequence:CCGGGTGCTAATGCTGGCTACTGTGCTCGAGCACAGTAGCCAGCATTAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006507.3-629s21c1
Sequence:CCGGGGATGTCTAGAACTGGTCCTGCTCGAGCAGGACCAGTTCTAGACATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006507.2-498s1c1
Sequence:CCGGCCTGACTTCATGCTCAGGATTCTCGAGAATCCTGAGCATGAAGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006507.2-152s1c1
Sequence:CCGGAGTCCCAGACAGAGCTGCCTACTCGAGTAGGCAGCTCTGTCTGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006507.2-273s1c1
Sequence:CCGGCCAGAACATGAATTCAGGCAACTCGAGTTGCCTGAATTCATGTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006507.2-335s1c1
Sequence:CCGGCCTCACTGATTAAGGAGAGTACTCGAGTACTCTCCTTAATCAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006507.2-506s1c1
Sequence:CCGGCATGCTCAGGATTCAAGAAATCTCGAGATTTCTTGAATCCTGAGCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006507
REG1B MISSION shRNA Lentiviral Transduction Particles
regenerating islet-derived 1 beta
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006507.3-504s21c1
Sequence:CCGGGTGCTAATGCTGGCTACTGTGCTCGAGCACAGTAGCCAGCATTAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006507.3-629s21c1
Sequence:CCGGGGATGTCTAGAACTGGTCCTGCTCGAGCAGGACCAGTTCTAGACATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006507.2-498s1c1
Sequence:CCGGCCTGACTTCATGCTCAGGATTCTCGAGAATCCTGAGCATGAAGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006507.2-152s1c1
Sequence:CCGGAGTCCCAGACAGAGCTGCCTACTCGAGTAGGCAGCTCTGTCTGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006507.2-273s1c1
Sequence:CCGGCCAGAACATGAATTCAGGCAACTCGAGTTGCCTGAATTCATGTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006507.2-335s1c1
Sequence:CCGGCCTCACTGATTAAGGAGAGTACTCGAGTACTCTCCTTAATCAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006507.2-506s1c1
Sequence:CCGGCATGCTCAGGATTCAAGAAATCTCGAGATTTCTTGAATCCTGAGCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)