EMAIL THIS PAGE TO A FRIEND

REG3A

regenerating islet-derived 3 alpha

80 Gene Product Result for
Synonyms: HIP HIP/PAP INGAP PAP PAP-H PAP1 PBCGF REG-III REG3
UniProtKB ID: Q06141
Gene ID:
Human(5068) Summary: This gene encodes a pancreatic secretory protein that may be involved in cell proliferation or differentiation. It has similarity to the C-type lectin superfamily. The enhanced expression of this gene is observed during pancreatic inflammation and liver carcinogenesis. Alternate splicing results in multiple transcript variants that encode the same protein.[provided by RefSeq, Dec 2010]
Mouse(19694) regenerating islet-derived 3 alpha
Rat(171162) regenerating islet-derived 3 alpha
cow(404114) regenerating islet-derived 3 alpha
dog(403411) regenerating islet-derived 3 alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1660 Human Reg3A ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002580 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002580 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002580 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011259 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011259 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011259 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU113481 MISSION® esiRNA esiRNA human REG3A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002580 Rosetta Predictions human pricing
NM_138937 Rosetta Predictions human pricing
NM_138938 Rosetta Predictions human pricing
NM_172077 Rosetta Predictions rat pricing
NM_011259 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002580 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035105 predicted 515
2 SASI_Hs01_00035106 predicted 517
3 SASI_Hs01_00035107 predicted 548
4 SASI_Hs01_00035108 predicted 484
5 SASI_Hs01_00035109 predicted 409
6 SASI_Hs01_00035110 predicted 501
7 SASI_Hs01_00035111 predicted 332
8 SASI_Hs01_00035112 predicted 536
9 SASI_Hs01_00035113 predicted 346
10 SASI_Hs01_00035114 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040587 predicted 489
2 SASI_Hs01_00040588 predicted 495
3 SASI_Hs01_00040589 predicted 520
4 SASI_Hs01_00040590 predicted 463
5 SASI_Hs01_00040591 predicted 382
6 SASI_Hs01_00040592 predicted 479
7 SASI_Hs01_00040593 predicted 314
8 SASI_Hs01_00040594 predicted 514
9 SASI_Hs01_00040595 predicted 326
10 SASI_Hs01_00040596 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084789 predicted 709
2 SASI_Hs01_00084790 predicted 712
3 SASI_Hs01_00084791 predicted 747
4 SASI_Hs01_00084792 predicted 680
5 SASI_Hs01_00084793 predicted 598
6 SASI_Hs01_00084794 predicted 698
7 SASI_Hs01_00084795 predicted 533
8 SASI_Hs01_00084796 predicted 724
9 SASI_Hs01_00084797 predicted 540
10 SASI_Hs01_00084798 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172077 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085357 predicted 433
2 SASI_Rn01_00085358 predicted 319
3 SASI_Rn01_00085359 predicted 520
4 SASI_Rn01_00085360 predicted 374
5 SASI_Rn01_00085362 predicted 284
6 SASI_Rn02_00269177 predicted 600
7 SASI_Rn01_00085363 predicted 199
8 SASI_Rn01_00085364 predicted 275
9 SASI_Rn01_00085365 predicted 511
10 SASI_Rn01_00085366 predicted 480
11 SASI_Rn01_00085361 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011259 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186767 predicted 299
2 SASI_Mm01_00186768 predicted 213
3 SASI_Mm01_00186769 predicted 546
4 SASI_Mm01_00186770 predicted 449
5 SASI_Mm01_00186771 predicted 611
6 SASI_Mm01_00186772 predicted 449
7 SASI_Mm01_00186773 predicted 526
8 SASI_Mm01_00186774 predicted 222
9 SASI_Mm02_00320264 predicted 291
10 SASI_Mm01_00186775 predicted 434
11 SASI_Mm01_00186776 predicted 614
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002580
REG3A MISSION shRNA Bacterial Glycerol Stock
regenerating islet-derived 3 alpha
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002580.1-614s21c1
Sequence:CCGGGTTTGGTGTGCAACTCATCATCTCGAGATGATGAGTTGCACACCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002580.1-548s21c1
Sequence:CCGGGTAATGTGAGGTTACCCTATGCTCGAGCATAGGGTAACCTCACATTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002580.1-344s21c1
Sequence:CCGGTTGGTAACAGCTACTCATACGCTCGAGCGTATGAGTAGCTGTTACCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002580.1-398s1c1
Sequence:CCGGCCGAGCCCAATGGAGAAGGTTCTCGAGAACCTTCTCCATTGGGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002580.1-512s1c1
Sequence:CCGGGAAGCACAGCATTTCTGAGGTCTCGAGACCTCAGAAATGCTGTGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002580.1-564s1c1
Sequence:CCGGCTATGTCTGCAAGTTCACTGACTCGAGTCAGTGAACTTGCAGACATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002580.1-112s1c1
Sequence:CCGGCTCATGCTGCTGTCTCAGGTTCTCGAGAACCTGAGACAGCAGCATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002580.1-330s1c1
Sequence:CCGGCCTGGTGAAGAGCATTGGTAACTCGAGTTACCAATGCTCTTCACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002580
REG3A MISSION shRNA shRNA Plasmid DNA
regenerating islet-derived 3 alpha
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002580.1-614s21c1
Sequence:CCGGGTTTGGTGTGCAACTCATCATCTCGAGATGATGAGTTGCACACCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002580.1-548s21c1
Sequence:CCGGGTAATGTGAGGTTACCCTATGCTCGAGCATAGGGTAACCTCACATTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002580.1-344s21c1
Sequence:CCGGTTGGTAACAGCTACTCATACGCTCGAGCGTATGAGTAGCTGTTACCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002580.1-398s1c1
Sequence:CCGGCCGAGCCCAATGGAGAAGGTTCTCGAGAACCTTCTCCATTGGGCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002580.1-512s1c1
Sequence:CCGGGAAGCACAGCATTTCTGAGGTCTCGAGACCTCAGAAATGCTGTGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002580.1-564s1c1
Sequence:CCGGCTATGTCTGCAAGTTCACTGACTCGAGTCAGTGAACTTGCAGACATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002580.1-112s1c1
Sequence:CCGGCTCATGCTGCTGTCTCAGGTTCTCGAGAACCTGAGACAGCAGCATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002580.1-330s1c1
Sequence:CCGGCCTGGTGAAGAGCATTGGTAACTCGAGTTACCAATGCTCTTCACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002580
REG3A MISSION shRNA Lentiviral Transduction Particles
regenerating islet-derived 3 alpha
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373368    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002580.1-614s21c1
Sequence:CCGGGTTTGGTGTGCAACTCATCATCTCGAGATGATGAGTTGCACACCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002580.1-548s21c1
Sequence:CCGGGTAATGTGAGGTTACCCTATGCTCGAGCATAGGGTAACCTCACATTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002580.1-344s21c1
Sequence:CCGGTTGGTAACAGCTACTCATACGCTCGAGCGTATGAGTAGCTGTTACCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062293    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002580.1-398s1c1
Sequence:CCGGCCGAGCCCAATGGAGAAGGTTCTCGAGAACCTTCTCCATTGGGCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002580.1-512s1c1
Sequence:CCGGGAAGCACAGCATTTCTGAGGTCTCGAGACCTCAGAAATGCTGTGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002580.1-564s1c1
Sequence:CCGGCTATGTCTGCAAGTTCACTGACTCGAGTCAGTGAACTTGCAGACATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002580.1-112s1c1
Sequence:CCGGCTCATGCTGCTGTCTCAGGTTCTCGAGAACCTGAGACAGCAGCATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062294    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002580.1-330s1c1
Sequence:CCGGCCTGGTGAAGAGCATTGGTAACTCGAGTTACCAATGCTCTTCACCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011259
REG3A MISSION shRNA Bacterial Glycerol Stock
regenerating islet-derived 3 alpha
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000191980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011259.1-139s1c1
Sequence:CCGGGTATTTCAGGTACAAGGTGAACTCGAGTTCACCTTGTACCTGAAATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011259.1-400s1c1
Sequence:CCGGGATCCAACAATGGGTCAACAACTCGAGTTGTTGACCCATTGTTGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011259.1-397s1c1
Sequence:CCGGCATGATCCAACAATGGGTCAACTCGAGTTGACCCATTGTTGGATCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011259.1-614s1c1
Sequence:CCGGGCATCCAGCATTTATCATGAACTCGAGTTCATGATAAATGCTGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011259.1-590s1c1
Sequence:CCGGGCAAGTTCAAGCAGTAGACAACTCGAGTTGTCTACTGCTTGAACTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192031    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011259.1-639s1c1
Sequence:CCGGCCCATGACAAGGGATGAAATACTCGAGTATTTCATCCCTTGTCATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011259.1-460s1c1
Sequence:CCGGCTGAATTATCTTAACTGGGATCTCGAGATCCCAGTTAAGATAATTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011259
REG3A MISSION shRNA shRNA Plasmid DNA
regenerating islet-derived 3 alpha
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000191980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011259.1-139s1c1
Sequence:CCGGGTATTTCAGGTACAAGGTGAACTCGAGTTCACCTTGTACCTGAAATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011259.1-400s1c1
Sequence:CCGGGATCCAACAATGGGTCAACAACTCGAGTTGTTGACCCATTGTTGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011259.1-397s1c1
Sequence:CCGGCATGATCCAACAATGGGTCAACTCGAGTTGACCCATTGTTGGATCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011259.1-614s1c1
Sequence:CCGGGCATCCAGCATTTATCATGAACTCGAGTTCATGATAAATGCTGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011259.1-590s1c1
Sequence:CCGGGCAAGTTCAAGCAGTAGACAACTCGAGTTGTCTACTGCTTGAACTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192031    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011259.1-639s1c1
Sequence:CCGGCCCATGACAAGGGATGAAATACTCGAGTATTTCATCCCTTGTCATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011259.1-460s1c1
Sequence:CCGGCTGAATTATCTTAACTGGGATCTCGAGATCCCAGTTAAGATAATTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011259
REG3A MISSION shRNA Lentiviral Transduction Particles
regenerating islet-derived 3 alpha
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000191980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011259.1-139s1c1
Sequence:CCGGGTATTTCAGGTACAAGGTGAACTCGAGTTCACCTTGTACCTGAAATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011259.1-400s1c1
Sequence:CCGGGATCCAACAATGGGTCAACAACTCGAGTTGTTGACCCATTGTTGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011259.1-397s1c1
Sequence:CCGGCATGATCCAACAATGGGTCAACTCGAGTTGACCCATTGTTGGATCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191602    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011259.1-614s1c1
Sequence:CCGGGCATCCAGCATTTATCATGAACTCGAGTTCATGATAAATGCTGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011259.1-590s1c1
Sequence:CCGGGCAAGTTCAAGCAGTAGACAACTCGAGTTGTCTACTGCTTGAACTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192031    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011259.1-639s1c1
Sequence:CCGGCCCATGACAAGGGATGAAATACTCGAGTATTTCATCCCTTGTCATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011259.1-460s1c1
Sequence:CCGGCTGAATTATCTTAACTGGGATCTCGAGATCCCAGTTAAGATAATTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)