EMAIL THIS PAGE TO A FRIEND

REG3G

regenerating islet-derived 3 gamma

72 Gene Product Result for
Synonyms: LPPM429 PAP IB PAP-1B PAP1B PAPIB REG III REG-III UNQ429
UniProtKB ID: Q6UW15, A8K980, D6W5J6, Q3SYE4, Q3SYE6, Q6FH18
Gene ID:
Human(130120) Summary: This gene encodes a member of the regenerating islet-derived genes (REG)3 protein family. These proteins are secreted, C-type lectins with a carbohydrate recognition domain and N-terminal signal peptide. The protein encoded by this gene is an antibacterial lectin with activity against Gram-positive bacteria. Alternative splicing results in multiple transcript variants encoding multiple isoforms. [provided by RefSeq, Jun 2012]
Mouse(19695) regenerating islet-derived 3 gamma
Rat(24620) regenerating islet-derived 3 gamma
cow(513652) regenerating islet-derived 3 gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301408 ANTI-REG3G (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB4301004 Anti-REG3G antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011260 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011260 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011260 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198448 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008387 Rosetta Predictions human pricing
NM_198448 Rosetta Predictions human pricing
NM_173097 Rosetta Predictions rat pricing
NM_011260 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218671 predicted 653
2 SASI_Hs01_00218672 predicted 629
3 SASI_Hs01_00218673 predicted 700
4 SASI_Hs01_00218674 predicted 454
5 SASI_Hs01_00218675 predicted 636
6 SASI_Hs01_00218676 predicted 516
7 SASI_Hs01_00218678 predicted 664
8 SASI_Hs01_00218679 predicted 470
9 SASI_Hs01_00218680 predicted 477
10 SASI_Hs02_00305415 predicted 688
11 SASI_Hs01_00218677 predicted 541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241681 predicted 560
2 SASI_Hs01_00241682 predicted 523
3 SASI_Hs01_00241683 predicted 597
4 SASI_Hs01_00241684 predicted 354
5 SASI_Hs01_00241685 predicted 533
6 SASI_Hs01_00241686 predicted 419
7 SASI_Hs01_00241688 predicted 566
8 SASI_Hs01_00241689 predicted 369
9 SASI_Hs01_00241690 predicted 370
10 SASI_Hs02_00371956 predicted 585
11 SASI_Hs01_00241687 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091240 predicted 280
2 SASI_Rn01_00091241 predicted 380
3 SASI_Rn01_00091242 predicted 394
4 SASI_Rn01_00091243 predicted 466
5 SASI_Rn01_00091244 predicted 522
6 SASI_Rn01_00091245 predicted 544
7 SASI_Rn01_00091247 predicted 365
8 SASI_Rn01_00091248 predicted 495
9 SASI_Rn01_00091249 predicted 360
10 SASI_Rn02_00269246 predicted 257
11 SASI_Rn01_00091246 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011260 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046214 predicted 396
2 SASI_Mm01_00046215 predicted 212
3 SASI_Mm01_00046216 predicted 504
4 SASI_Mm01_00046217 predicted 316
5 SASI_Mm01_00046218 predicted 398
6 SASI_Mm01_00046219 predicted 548
7 SASI_Mm01_00046220 predicted 405
8 SASI_Mm01_00046221 predicted 473
9 SASI_Mm01_00046222 predicted 310
10 SASI_Mm01_00046223 predicted 367
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011260
REG3G MISSION shRNA Bacterial Glycerol Stock
regenerating islet-derived 3 gamma
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011260.1-496s21c1
Sequence:CCGGTGAAGTGGAGAGAGAATTATTCTCGAGAATAATTCTCTCTCCACTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011260.1-184s1c1
Sequence:CCGGGCTATGCCTTGTTTAGTGTATCTCGAGATACACTAAACAAGGCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011260.1-315s21c1
Sequence:CCGGAGTGGTAACAGTGGCCAATATCTCGAGATATTGGCCACTGTTACCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011260.1-401s1c1
Sequence:CCGGCAATGCTGATGTGATGAATTACTCGAGTAATTCATCACATCAGCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011260.1-594s1c1
Sequence:CCGGGCCACAAGCAAGATCCCAAATCTCGAGATTTGGGATCTTGCTTGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011260.1-401s21c1
Sequence:CCGGCAATGCTGATGTGATGAATTACTCGAGTAATTCATCACATCAGCATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011260.1-567s21c1
Sequence:CCGGTTGACATCATGGGTTGATATACTCGAGTATATCAACCCATGATGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011260.1-185s21c1
Sequence:CCGGCTATGCCTTGTTTAGTGTATCCTCGAGGATACACTAAACAAGGCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011260
REG3G MISSION shRNA shRNA Plasmid DNA
regenerating islet-derived 3 gamma
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011260.1-496s21c1
Sequence:CCGGTGAAGTGGAGAGAGAATTATTCTCGAGAATAATTCTCTCTCCACTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011260.1-184s1c1
Sequence:CCGGGCTATGCCTTGTTTAGTGTATCTCGAGATACACTAAACAAGGCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011260.1-315s21c1
Sequence:CCGGAGTGGTAACAGTGGCCAATATCTCGAGATATTGGCCACTGTTACCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011260.1-401s1c1
Sequence:CCGGCAATGCTGATGTGATGAATTACTCGAGTAATTCATCACATCAGCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011260.1-594s1c1
Sequence:CCGGGCCACAAGCAAGATCCCAAATCTCGAGATTTGGGATCTTGCTTGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011260.1-401s21c1
Sequence:CCGGCAATGCTGATGTGATGAATTACTCGAGTAATTCATCACATCAGCATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011260.1-567s21c1
Sequence:CCGGTTGACATCATGGGTTGATATACTCGAGTATATCAACCCATGATGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011260.1-185s21c1
Sequence:CCGGCTATGCCTTGTTTAGTGTATCCTCGAGGATACACTAAACAAGGCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011260
REG3G MISSION shRNA Lentiviral Transduction Particles
regenerating islet-derived 3 gamma
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011260.1-496s21c1
Sequence:CCGGTGAAGTGGAGAGAGAATTATTCTCGAGAATAATTCTCTCTCCACTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011260.1-184s1c1
Sequence:CCGGGCTATGCCTTGTTTAGTGTATCTCGAGATACACTAAACAAGGCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011260.1-315s21c1
Sequence:CCGGAGTGGTAACAGTGGCCAATATCTCGAGATATTGGCCACTGTTACCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011260.1-401s1c1
Sequence:CCGGCAATGCTGATGTGATGAATTACTCGAGTAATTCATCACATCAGCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182598    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011260.1-594s1c1
Sequence:CCGGGCCACAAGCAAGATCCCAAATCTCGAGATTTGGGATCTTGCTTGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011260.1-401s21c1
Sequence:CCGGCAATGCTGATGTGATGAATTACTCGAGTAATTCATCACATCAGCATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011260.1-567s21c1
Sequence:CCGGTTGACATCATGGGTTGATATACTCGAGTATATCAACCCATGATGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011260.1-185s21c1
Sequence:CCGGCTATGCCTTGTTTAGTGTATCCTCGAGGATACACTAAACAAGGCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198448
REG3G MISSION shRNA Bacterial Glycerol Stock
regenerating islet-derived 3 gamma
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-366s1c1
Sequence:CCGGGCATTAGTAACAGCTACTCATCTCGAGATGAGTAGCTGTTACTAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-575s1c1
Sequence:CCGGGATGCAAAGTTACCCTATGTCCTCGAGGACATAGGGTAACTTTGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-469s1c1
Sequence:CCGGGAATTACTTTGCATGGGAGAACTCGAGTTCTCCCATGCAAAGTAATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-361s1c1
Sequence:CCGGGAGGAGCATTAGTAACAGCTACTCGAGTAGCTGTTACTAATGCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-534s1c1
Sequence:CCGGCAAGAAGCACAGGATTTCTGACTCGAGTCAGAAATCCTGTGCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-137s1c1
Sequence:CCGGCTCATTCTCCTGTGTCAGGTTCTCGAGAACCTGACACAGGAGAATGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-448s1c1
Sequence:CCGGGTGGAGTAGCACTGATGTGATCTCGAGATCACATCAGTGCTACTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141264    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198448.2-682s1c1
Sequence:CCGGCTCACCCTGGAAGAGAATATTCTCGAGAATATTCTCTTCCAGGGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-583s1c1
Sequence:CCGGGTTACCCTATGTCTGCAAGTTCTCGAGAACTTGCAGACATAGGGTAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.2-376s1c1
Sequence:CCGGCAGCTATTCATACATCTGGATCTCGAGATCCAGATGTATGAATAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198448
REG3G MISSION shRNA shRNA Plasmid DNA
regenerating islet-derived 3 gamma
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-366s1c1
Sequence:CCGGGCATTAGTAACAGCTACTCATCTCGAGATGAGTAGCTGTTACTAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-575s1c1
Sequence:CCGGGATGCAAAGTTACCCTATGTCCTCGAGGACATAGGGTAACTTTGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-469s1c1
Sequence:CCGGGAATTACTTTGCATGGGAGAACTCGAGTTCTCCCATGCAAAGTAATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-361s1c1
Sequence:CCGGGAGGAGCATTAGTAACAGCTACTCGAGTAGCTGTTACTAATGCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-534s1c1
Sequence:CCGGCAAGAAGCACAGGATTTCTGACTCGAGTCAGAAATCCTGTGCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-137s1c1
Sequence:CCGGCTCATTCTCCTGTGTCAGGTTCTCGAGAACCTGACACAGGAGAATGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-448s1c1
Sequence:CCGGGTGGAGTAGCACTGATGTGATCTCGAGATCACATCAGTGCTACTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141264    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198448.2-682s1c1
Sequence:CCGGCTCACCCTGGAAGAGAATATTCTCGAGAATATTCTCTTCCAGGGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-583s1c1
Sequence:CCGGGTTACCCTATGTCTGCAAGTTCTCGAGAACTTGCAGACATAGGGTAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.2-376s1c1
Sequence:CCGGCAGCTATTCATACATCTGGATCTCGAGATCCAGATGTATGAATAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198448
REG3G MISSION shRNA Lentiviral Transduction Particles
regenerating islet-derived 3 gamma
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-366s1c1
Sequence:CCGGGCATTAGTAACAGCTACTCATCTCGAGATGAGTAGCTGTTACTAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-575s1c1
Sequence:CCGGGATGCAAAGTTACCCTATGTCCTCGAGGACATAGGGTAACTTTGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-469s1c1
Sequence:CCGGGAATTACTTTGCATGGGAGAACTCGAGTTCTCCCATGCAAAGTAATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-361s1c1
Sequence:CCGGGAGGAGCATTAGTAACAGCTACTCGAGTAGCTGTTACTAATGCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-534s1c1
Sequence:CCGGCAAGAAGCACAGGATTTCTGACTCGAGTCAGAAATCCTGTGCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-137s1c1
Sequence:CCGGCTCATTCTCCTGTGTCAGGTTCTCGAGAACCTGACACAGGAGAATGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-448s1c1
Sequence:CCGGGTGGAGTAGCACTGATGTGATCTCGAGATCACATCAGTGCTACTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141264    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198448.2-682s1c1
Sequence:CCGGCTCACCCTGGAAGAGAATATTCTCGAGAATATTCTCTTCCAGGGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.1-583s1c1
Sequence:CCGGGTTACCCTATGTCTGCAAGTTCTCGAGAACTTGCAGACATAGGGTAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198448.2-376s1c1
Sequence:CCGGCAGCTATTCATACATCTGGATCTCGAGATCCAGATGTATGAATAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)