EMAIL THIS PAGE TO A FRIEND

RELA

v-rel avian reticuloendotheliosis viral oncogene homolog A

217 Gene Product Result for
Synonyms: NFKB3 p65
UniProtKB ID: Q04206, Q6GTV1, Q6SLK1
Gene ID:
Human(5970) Summary: NF-kappa-B is a ubiquitous transcription factor involved in several biological processes. It is held in the cytoplasm in an inactive state by specific inhibitors. Upon degradation of the inhibitor, NF-kappa-B moves to the nucleus and activates transcription of specific genes. NF-kappa-B is composed of NFKB1 or NFKB2 bound to either REL, RELA, or RELB. The most abundant form of NF-kappa-B is NFKB1 complexed with the product of this gene, RELA. Four transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
Mouse(19697) v-rel reticuloendotheliosis viral oncogene homolog A (avian)
Rat(309165) v-rel avian reticuloendotheliosis viral oncogene homolog A
naked mole-rat(101716738) v-rel reticuloendotheliosis viral oncogene homolog A (avian)
domestic guinea pig(100724366) v-rel reticuloendotheliosis viral oncogene homolog A (avian)
cow(508233) v-rel reticuloendotheliosis viral oncogene homolog A (avian)
sheep(101102191) v-rel reticuloendotheliosis viral oncogene homolog A (avian)
Zebrafish(415099) v-rel reticuloendotheliosis viral oncogene homolog A
domestic cat(101096604) v-rel reticuloendotheliosis viral oncogene homolog A (avian)
dog(483729) v-rel reticuloendotheliosis viral oncogene homolog A (avian)
chicken(396027) v-rel reticuloendotheliosis viral oncogene homolog A (avian)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502616 Anti-NF-κB p65 (Acetyl-Lys310) antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502615 Anti-NF-κB p65 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB5700780 Anti-NF-kB p65 antibody produced in rabbit mouse, rat, human
immunofluorescence, immunohistochemistry, immunoprecipitation (IP), western blot pricing
SAB5700046 Anti-NF-kB p65 antibody produced in rabbit human, mouse
western blot pricing
SAB5700683 Anti-NF-kB p65 antibody produced in rabbit human, mouse, rat
western blot pricing
SAB4502609 Anti-NF-κB p65 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB4502610 Anti-NF-κB p65 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502613 Anti-NF-κB p65 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4502617 Anti-NF-κB p65 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502608 Anti-NF-κB p65, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4502614 Anti-NF-κB p65, C-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1305598 ANTI-PHOSPHO-NF KAPPA B(S536) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB4504488 Anti-phospho-NF-kappaB p65 (pSer276) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504482 Anti-phospho-NF-kappaB p65 (pSer311) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504489 Anti-phospho-NF-kappaB p65 (pSer468) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504481 Anti-phospho-NF-kappaB p65 (pSer529) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504490 Anti-phospho-NF-kappaB p65 (pSer536) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4504491 Anti-phospho-NF-kappaB p65 (pThr254) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4504492 Anti-phospho-NF-kappaB p65 (pThr435) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4503949 Anti-phospho-NF-kappaB p65 (pThr505) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing
SAB4301496 Anti-phospho-NF-κB p65 (pSer281) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
SAB5700333 Anti-Phospho-NF-kB p65-S276 antibody produced in rabbit mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB5700357 Anti-Phospho-NF-kB p65-S311 antibody produced in rabbit human, mouse
immunohistochemistry, western blot pricing
SAB5700363 Anti-Phospho-NF-kB p65-S536 antibody produced in rabbit mouse, human, rat
immunohistochemistry, western blot pricing
SAB4300009 Anti-phospho-RELA (p65/pSer536) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300008 Anti-phospho-RELA (p65/pThr254) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300174 Anti-phospho-RELA (pSer529) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB5700358 Anti-Phospho-RELA-S468 antibody produced in rabbit mouse, human
western blot pricing
SAB5700555 Anti-Phospho-RELA-S529 antibody produced in rabbit human, mouse, rat
western blot pricing
SAB5700500 Anti-Phospho-RELA-T435 antibody produced in rabbit human, mouse
western blot pricing
SAB1100404 Anti-RELA (51-65) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300294 Anti-RELA (Ab-254) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry pricing
SAB4300295 Anti-RELA (Ab-276) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300506 Anti-RELA (Ab-311) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB4300296 Anti-RELA (Ab-435) antibody produced in rabbit affinity isolated antibody monkey, human, rat, mouse
immunohistochemistry, western blot pricing
SAB4300297 Anti-RELA (Ab-468) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4300442 Anti-RELA (Ab-505) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB4300469 Anti-RELA (Ab-529) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300298 Anti-RELA (Ab-536) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
HPA063461 Anti-RELA antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
AV100779 Anti-RELA antibody produced in rabbit IgG fraction of antiserum rat, horse, mouse, human, bovine, guinea pig
western blot pricing
PLA0308 Goat anti-RelA Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, human
immunoprecipitation (IP), western blot pricing
SAB1413083 Monoclonal Anti-RELA (phospho S529) antibody produced in rabbit clone A2 New human
western blot pricing
SAB1413084 Monoclonal Anti-RELA (phospho S529) antibody produced in rabbit clone H3 New human
flow cytometry pricing
SAB1413046 Monoclonal Anti-RELA (phospho S536) antibody produced in rabbit clone C8 New human
western blot pricing
SAB1413081 Monoclonal Anti-RELA (phospho S536) antibody produced in rabbit clone B7 New human
flow cytometry, western blot pricing
SAB1413246 Monoclonal Anti-RELA (phospho S536) antibody produced in rabbit clone C8 New human
western blot pricing
SAB1404309 Monoclonal Anti-RELA antibody produced in mouse clone 8G3, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009045 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009045 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009045 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021975 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021975 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021975 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021975 siRNAs that have been validated in the lab human pricing
NM_199267 Rosetta Predictions rat pricing
NM_009045 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021975 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171091 validated 420
2 SASI_Hs01_00171090 predicted 733
3 SASI_Hs01_00171092 predicted 1532
4 SASI_Hs01_00171093 predicted 646
5 SASI_Hs01_00171095 predicted 960
6 SASI_Hs02_00355327 predicted 961
7 SASI_Hs01_00171096 predicted 691
8 SASI_Hs02_00355328 predicted 956
9 SASI_Hs01_00171098 predicted 808
10 SASI_Hs02_00355329 predicted 802
11 SASI_Hs01_00171089 predicted 562
12 SASI_Hs01_00171094 predicted 294
13 SASI_Hs01_00171097 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199267 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122065 predicted 637
2 SASI_Rn01_00122066 predicted 722
3 SASI_Rn01_00122067 predicted 1130
4 SASI_Rn01_00122068 predicted 992
5 SASI_Rn01_00122069 predicted 270
6 SASI_Rn01_00122070 predicted 688
7 SASI_Rn01_00122071 predicted 237
8 SASI_Rn01_00122072 predicted 1699
9 SASI_Rn02_00270164 predicted 1466
10 SASI_Rn01_00122073 predicted 350
11 SASI_Rn01_00122074 predicted 444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009045 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060588 predicted 1253
2 SASI_Mm01_00060589 predicted 1003
3 SASI_Mm01_00060590 predicted 1233
4 SASI_Mm01_00060591 predicted 1274
5 SASI_Mm01_00060592 predicted 1407
6 SASI_Mm01_00060593 predicted 1210
7 SASI_Mm01_00060594 predicted 723
8 SASI_Mm01_00060595 predicted 1443
9 SASI_Mm02_00315204 predicted 1202
10 SASI_Mm01_00060596 predicted 734
11 SASI_Mm01_00060587 predicted 926
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009045
VALIDATED
RELA MISSION shRNA Bacterial Glycerol Stock
v-rel avian reticuloendotheliosis viral oncogene homolog A
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009045.4-1406s21c1
Sequence:CCGGCCCTCAGCACCATCAACTTTGCTCGAGCAAAGTTGATGGTGCTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009045.4-1008s21c1
Sequence:CCGGAGAAGACATTGAGGTGTATTTCTCGAGAAATACACCTCAATGTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009045.4-740s21c1
Sequence:CCGGAGCGAATCCAGACCAACAATACTCGAGTATTGTTGGTCTGGATTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009045.4-1824s21c1
Sequence:CCGGGGAGTACCCTGAAGCTATAACCTCGAGGTTATAGCTTCAGGGTACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009045.4-924s21c1
Sequence:CCGGGCTCAAGATCTGCCGAGTAAACTCGAGTTTACTCGGCAGATCTTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009045.4-2313s21c1
Sequence:CCGGAGGCCATATAGCCTTACTATCCTCGAGGATAGTAAGGCTATATGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009045.4-437s21c1
Sequence:CCGGGCATGCGATTCCGCTATAAATCTCGAGATTTATAGCGGAATCGCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009045.4-1261s21c1
Sequence:CCGGTATGAGACCTTCAAGAGTATCCTCGAGGATACTCTTGAAGGTCTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009045.2-500s1c1
Sequence:CCGGGCGAATCCAGACCAACAATAACTCGAGTTATTGTTGGTCTGGATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009045.2-1713s1c1
Sequence:CCGGGACATGGACTTCTCTGCTCTTCTCGAGAAGAGCAGAGAAGTCCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009045.2-634s1c1
Sequence:CCGGCTGTCCTCTCACATCCGATTTCTCGAGAAATCGGATGTGAGAGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009045.2-1503s1c1
Sequence:CCGGTCTGTGGACAACTCAGAGTTTCTCGAGAAACTCTGAGTTGTCCACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009045.4-875s21c1
Sequence:CCGGCTGTCCTCTCACATCCGATTTCTCGAGAAATCGGATGTGAGAGGACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009045
VALIDATED
RELA MISSION shRNA shRNA Plasmid DNA
v-rel avian reticuloendotheliosis viral oncogene homolog A
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009045.4-1406s21c1
Sequence:CCGGCCCTCAGCACCATCAACTTTGCTCGAGCAAAGTTGATGGTGCTGAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000360657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009045.4-1008s21c1
Sequence:CCGGAGAAGACATTGAGGTGTATTTCTCGAGAAATACACCTCAATGTCTTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000244320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009045.4-740s21c1
Sequence:CCGGAGCGAATCCAGACCAACAATACTCGAGTATTGTTGGTCTGGATTCGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000235833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009045.4-1824s21c1
Sequence:CCGGGGAGTACCCTGAAGCTATAACCTCGAGGTTATAGCTTCAGGGTACTCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000235834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009045.4-924s21c1
Sequence:CCGGGCTCAAGATCTGCCGAGTAAACTCGAGTTTACTCGGCAGATCTTGAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000235832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009045.4-2313s21c1
Sequence:CCGGAGGCCATATAGCCTTACTATCCTCGAGGATAGTAAGGCTATATGGCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000244319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009045.4-437s21c1
Sequence:CCGGGCATGCGATTCCGCTATAAATCTCGAGATTTATAGCGGAATCGCATGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000360586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009045.4-1261s21c1
Sequence:CCGGTATGAGACCTTCAAGAGTATCCTCGAGGATACTCTTGAAGGTCTCATATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000055343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009045.2-500s1c1
Sequence:CCGGGCGAATCCAGACCAACAATAACTCGAGTTATTGTTGGTCTGGATTCGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000055344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009045.2-1713s1c1
Sequence:CCGGGACATGGACTTCTCTGCTCTTCTCGAGAAGAGCAGAGAAGTCCATGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000055346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009045.2-634s1c1
Sequence:CCGGCTGTCCTCTCACATCCGATTTCTCGAGAAATCGGATGTGAGAGGACAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000055347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009045.2-1503s1c1
Sequence:CCGGTCTGTGGACAACTCAGAGTTTCTCGAGAAACTCTGAGTTGTCCACAGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000301864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009045.4-875s21c1
Sequence:CCGGCTGTCCTCTCACATCCGATTTCTCGAGAAATCGGATGTGAGAGGACAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009045
VALIDATED
RELA MISSION shRNA Lentiviral Transduction Particles
v-rel avian reticuloendotheliosis viral oncogene homolog A
Mouse
13 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000360656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009045.4-1406s21c1
Sequence:CCGGCCCTCAGCACCATCAACTTTGCTCGAGCAAAGTTGATGGTGCTGAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009045.4-1008s21c1
Sequence:CCGGAGAAGACATTGAGGTGTATTTCTCGAGAAATACACCTCAATGTCTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009045.4-740s21c1
Sequence:CCGGAGCGAATCCAGACCAACAATACTCGAGTATTGTTGGTCTGGATTCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235833    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009045.4-1824s21c1
Sequence:CCGGGGAGTACCCTGAAGCTATAACCTCGAGGTTATAGCTTCAGGGTACTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009045.4-924s21c1
Sequence:CCGGGCTCAAGATCTGCCGAGTAAACTCGAGTTTACTCGGCAGATCTTGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235832    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009045.4-2313s21c1
Sequence:CCGGAGGCCATATAGCCTTACTATCCTCGAGGATAGTAAGGCTATATGGCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009045.4-437s21c1
Sequence:CCGGGCATGCGATTCCGCTATAAATCTCGAGATTTATAGCGGAATCGCATGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009045.4-1261s21c1
Sequence:CCGGTATGAGACCTTCAAGAGTATCCTCGAGGATACTCTTGAAGGTCTCATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009045.2-500s1c1
Sequence:CCGGGCGAATCCAGACCAACAATAACTCGAGTTATTGTTGGTCTGGATTCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009045.2-1713s1c1
Sequence:CCGGGACATGGACTTCTCTGCTCTTCTCGAGAAGAGCAGAGAAGTCCATGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009045.2-634s1c1
Sequence:CCGGCTGTCCTCTCACATCCGATTTCTCGAGAAATCGGATGTGAGAGGACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009045.2-1503s1c1
Sequence:CCGGTCTGTGGACAACTCAGAGTTTCTCGAGAAACTCTGAGTTGTCCACAGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009045.4-875s21c1
Sequence:CCGGCTGTCCTCTCACATCCGATTTCTCGAGAAATCGGATGTGAGAGGACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021975
VALIDATED
RELA MISSION shRNA Bacterial Glycerol Stock
v-rel avian reticuloendotheliosis viral oncogene homolog A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021975.3-2189s21c1
Sequence:CCGGATGGATTCATTACAGCTTAATCTCGAGATTAAGCTGTAATGAATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021975.3-1029s21c1
Sequence:CCGGCGGATTGAGGAGAAACGTAAACTCGAGTTTACGTTTCTCCTCAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021975.3-1622s21c1
Sequence:CCGGGGAGTACCCTGAGGCTATAACCTCGAGGTTATAGCCTCAGGGTACTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_021975.1-2282s1c1
Sequence:CCGGGCCTTAATAGTAGGGTAAGTTCTCGAGAACTTACCCTACTATTAAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_021975.1-380s1c1
Sequence:CCGGGCAGGCTATCAGTCAGCGCATCTCGAGATGCGCTGACTGATAGCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_021975.1-1488s1c1
Sequence:CCGGCCTGAGGCTATAACTCGCCTACTCGAGTAGGCGAGTTATAGCCTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021975.1-1067s1c1
Sequence:CCGGCACCATCAACTATGATGAGTTCTCGAGAACTCATCATAGTTGATGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_021975.1-888s1c1
Sequence:CCGGCGGATTGAGGAGAAACGTAAACTCGAGTTTACGTTTCTCCTCAATCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021975.3-803s21c1
Sequence:CCGGAGAGGACATTGAGGTGTATTTCTCGAGAAATACACCTCAATGTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021975.3-1201s21c1
Sequence:CCGGCCCTGAGCACCATCAACTATGCTCGAGCATAGTTGATGGTGCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021975
VALIDATED
RELA MISSION shRNA shRNA Plasmid DNA
v-rel avian reticuloendotheliosis viral oncogene homolog A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021975.3-2189s21c1
Sequence:CCGGATGGATTCATTACAGCTTAATCTCGAGATTAAGCTGTAATGAATCCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000329800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021975.3-1029s21c1
Sequence:CCGGCGGATTGAGGAGAAACGTAAACTCGAGTTTACGTTTCTCCTCAATCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000329875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021975.3-1622s21c1
Sequence:CCGGGGAGTACCCTGAGGCTATAACCTCGAGGTTATAGCCTCAGGGTACTCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000014683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_021975.1-2282s1c1
Sequence:CCGGGCCTTAATAGTAGGGTAAGTTCTCGAGAACTTACCCTACTATTAAGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000014685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_021975.1-380s1c1
Sequence:CCGGGCAGGCTATCAGTCAGCGCATCTCGAGATGCGCTGACTGATAGCCTGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000014687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_021975.1-1488s1c1
Sequence:CCGGCCTGAGGCTATAACTCGCCTACTCGAGTAGGCGAGTTATAGCCTCAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000014686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021975.1-1067s1c1
Sequence:CCGGCACCATCAACTATGATGAGTTCTCGAGAACTCATCATAGTTGATGGTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000014684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_021975.1-888s1c1
Sequence:CCGGCGGATTGAGGAGAAACGTAAACTCGAGTTTACGTTTCTCCTCAATCCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000353629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021975.3-803s21c1
Sequence:CCGGAGAGGACATTGAGGTGTATTTCTCGAGAAATACACCTCAATGTCCTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000329802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021975.3-1201s21c1
Sequence:CCGGCCCTGAGCACCATCAACTATGCTCGAGCATAGTTGATGGTGCTCAGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021975
VALIDATED
RELA MISSION shRNA Lentiviral Transduction Particles
v-rel avian reticuloendotheliosis viral oncogene homolog A
Human
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000329877    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021975.3-2189s21c1
Sequence:CCGGATGGATTCATTACAGCTTAATCTCGAGATTAAGCTGTAATGAATCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021975.3-1029s21c1
Sequence:CCGGCGGATTGAGGAGAAACGTAAACTCGAGTTTACGTTTCTCCTCAATCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021975.3-1622s21c1
Sequence:CCGGGGAGTACCCTGAGGCTATAACCTCGAGGTTATAGCCTCAGGGTACTCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_021975.1-2282s1c1
Sequence:CCGGGCCTTAATAGTAGGGTAAGTTCTCGAGAACTTACCCTACTATTAAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_021975.1-380s1c1
Sequence:CCGGGCAGGCTATCAGTCAGCGCATCTCGAGATGCGCTGACTGATAGCCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_021975.1-1488s1c1
Sequence:CCGGCCTGAGGCTATAACTCGCCTACTCGAGTAGGCGAGTTATAGCCTCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_021975.1-1067s1c1
Sequence:CCGGCACCATCAACTATGATGAGTTCTCGAGAACTCATCATAGTTGATGGTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_021975.1-888s1c1
Sequence:CCGGCGGATTGAGGAGAAACGTAAACTCGAGTTTACGTTTCTCCTCAATCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021975.3-803s21c1
Sequence:CCGGAGAGGACATTGAGGTGTATTTCTCGAGAAATACACCTCAATGTCCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021975.3-1201s21c1
Sequence:CCGGCCCTGAGCACCATCAACTATGCTCGAGCATAGTTGATGGTGCTCAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)