EMAIL THIS PAGE TO A FRIEND

RELL1

RELT-like 1

58 Gene Product Result for
UniProtKB ID: Q8IUW5, Q8NBK1
Gene ID:
Mouse(100532) RELT-like 1
Rat(289635) RELT-like 1
chicken(422795) RELT-like 1
dog(479117) RELT-like 1
cow(768210) RELT-like 1
sheep(101110843) RELT-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA013377 Anti-RELL1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing

miRNA Primer

Product # Description Species Add to Cart
 
MIRAP00656 MystiCq® microRNA qPCR Assay Primer hsa-miR-663a human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145923 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145923 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145923 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001085399 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001085399 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001085399 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001085399 Rosetta Predictions human pricing
NM_001085400 Rosetta Predictions human pricing
NM_001113776 Rosetta Predictions rat pricing
NM_145923 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317595 predicted 468
2 SASI_Hs02_00317596 predicted 404
3 SASI_Hs02_00317597 predicted 438
4 SASI_Hs02_00317598 predicted 276
5 SASI_Hs02_00317599 predicted 672
6 SASI_Hs02_00317600 predicted 331
7 SASI_Hs02_00317601 predicted 337
8 SASI_Hs02_00317602 predicted 687
9 SASI_Hs02_00317603 predicted 611
10 SASI_Hs02_00317604 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317605 predicted 465
2 SASI_Hs02_00317606 predicted 406
3 SASI_Hs02_00317607 predicted 438
4 SASI_Hs02_00317608 predicted 267
5 SASI_Hs02_00317609 predicted 668
6 SASI_Hs02_00317610 predicted 338
7 SASI_Hs02_00317611 predicted 336
8 SASI_Hs02_00317612 predicted 686
9 SASI_Hs02_00317613 predicted 616
10 SASI_Hs02_00317614 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113776 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252023 predicted 1026
2 SASI_Rn02_00252024 predicted 296
3 SASI_Rn02_00252025 predicted 1051
4 SASI_Rn02_00252026 predicted 1080
5 SASI_Rn02_00252027 predicted 989
6 SASI_Rn02_00252028 predicted 428
7 SASI_Rn02_00252029 predicted 1001
8 SASI_Rn02_00252030 predicted 402
9 SASI_Rn02_00252031 predicted 254
10 SASI_Rn02_00252032 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145923 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134070 predicted 1136
2 SASI_Mm01_00134072 predicted 578
3 SASI_Mm01_00134073 predicted 511
4 SASI_Mm01_00134074 predicted 551
5 SASI_Mm01_00134075 predicted 474
6 SASI_Mm02_00341375 predicted 390
7 SASI_Mm01_00134079 predicted 1024
8 SASI_Mm02_00341376 predicted 676
9 SASI_Mm02_00341377 predicted 1249
10 SASI_Mm02_00341378 predicted 850
11 SASI_Mm01_00134071 predicted 1351
12 SASI_Mm01_00134076 predicted 1359
13 SASI_Mm01_00134077 predicted 1271
14 SASI_Mm01_00134078 predicted 461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145923
VALIDATED
RELL1 MISSION shRNA Bacterial Glycerol Stock
RELT-like 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145923.4-884s21c1
Sequence:CCGGGAAGGAGCGCAGAAGTTTGATCTCGAGATCAAACTTCTGCGCTCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145923.4-521s21c1
Sequence:CCGGCCAGATTGTCCAGTACATTATCTCGAGATAATGTACTGGACAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215842    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145923.4-1393s1c1
Sequence:CCGGCTTTGGCCCTAAGATCTTAATCTCGAGATTAAGATCTTAGGGCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145923.4-392s1c1
Sequence:CCGGCCTCATCTGTCACTTACTTAACTCGAGTTAAGTAAGTGACAGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145923.4-758s1c1
Sequence:CCGGCAAGCGATGGCACTTCATAAACTCGAGTTTATGAAGTGCCATCGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145923.4-476s21c1
Sequence:CCGGGATAGAGTTGAATGACAGTATCTCGAGATACTGTCATTCAACTCTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145923.4-2063s21c1
Sequence:CCGGCCCTACTTCCATTGGTGTGATCTCGAGATCACACCAATGGAAGTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145923.1-828s1c1
Sequence:CCGGCGAAAGTGGAGCACAAGTCAACTCGAGTTGACTTGTGCTCCACTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145923.1-567s1c1
Sequence:CCGGGCGATATTGAAAGCCCTGTCACTCGAGTGACAGGGCTTTCAATATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145923.1-861s1c1
Sequence:CCGGGCAGAAGTTTGATGTCTGTCACTCGAGTGACAGACATCAAACTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145923.1-445s1c1
Sequence:CCGGGATAGAGTTGAATGACAGTATCTCGAGATACTGTCATTCAACTCTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145923.1-853s1c1
Sequence:CCGGGAAGGAGCGCAGAAGTTTGATCTCGAGATCAAACTTCTGCGCTCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145923.1-2032s1c1
Sequence:CCGGCCCTACTTCCATTGGTGTGATCTCGAGATCACACCAATGGAAGTAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145923
VALIDATED
RELL1 MISSION shRNA shRNA Plasmid DNA
RELT-like 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145923.4-884s21c1
Sequence:CCGGGAAGGAGCGCAGAAGTTTGATCTCGAGATCAAACTTCTGCGCTCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145923.4-521s21c1
Sequence:CCGGCCAGATTGTCCAGTACATTATCTCGAGATAATGTACTGGACAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215842    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145923.4-1393s1c1
Sequence:CCGGCTTTGGCCCTAAGATCTTAATCTCGAGATTAAGATCTTAGGGCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145923.4-392s1c1
Sequence:CCGGCCTCATCTGTCACTTACTTAACTCGAGTTAAGTAAGTGACAGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145923.4-758s1c1
Sequence:CCGGCAAGCGATGGCACTTCATAAACTCGAGTTTATGAAGTGCCATCGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000277274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145923.4-476s21c1
Sequence:CCGGGATAGAGTTGAATGACAGTATCTCGAGATACTGTCATTCAACTCTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145923.4-2063s21c1
Sequence:CCGGCCCTACTTCCATTGGTGTGATCTCGAGATCACACCAATGGAAGTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145923.1-828s1c1
Sequence:CCGGCGAAAGTGGAGCACAAGTCAACTCGAGTTGACTTGTGCTCCACTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145923.1-567s1c1
Sequence:CCGGGCGATATTGAAAGCCCTGTCACTCGAGTGACAGGGCTTTCAATATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145923.1-861s1c1
Sequence:CCGGGCAGAAGTTTGATGTCTGTCACTCGAGTGACAGACATCAAACTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145923.1-445s1c1
Sequence:CCGGGATAGAGTTGAATGACAGTATCTCGAGATACTGTCATTCAACTCTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145923.1-853s1c1
Sequence:CCGGGAAGGAGCGCAGAAGTTTGATCTCGAGATCAAACTTCTGCGCTCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145923.1-2032s1c1
Sequence:CCGGCCCTACTTCCATTGGTGTGATCTCGAGATCACACCAATGGAAGTAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145923
VALIDATED
RELL1 MISSION shRNA Lentiviral Transduction Particles
RELT-like 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145923.4-884s21c1
Sequence:CCGGGAAGGAGCGCAGAAGTTTGATCTCGAGATCAAACTTCTGCGCTCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285909    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145923.4-521s21c1
Sequence:CCGGCCAGATTGTCCAGTACATTATCTCGAGATAATGTACTGGACAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215842    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145923.4-1393s1c1
Sequence:CCGGCTTTGGCCCTAAGATCTTAATCTCGAGATTAAGATCTTAGGGCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217278    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145923.4-392s1c1
Sequence:CCGGCCTCATCTGTCACTTACTTAACTCGAGTTAAGTAAGTGACAGATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217760    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145923.4-758s1c1
Sequence:CCGGCAAGCGATGGCACTTCATAAACTCGAGTTTATGAAGTGCCATCGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000277274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145923.4-476s21c1
Sequence:CCGGGATAGAGTTGAATGACAGTATCTCGAGATACTGTCATTCAACTCTATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145923.4-2063s21c1
Sequence:CCGGCCCTACTTCCATTGGTGTGATCTCGAGATCACACCAATGGAAGTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200190    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145923.1-828s1c1
Sequence:CCGGCGAAAGTGGAGCACAAGTCAACTCGAGTTGACTTGTGCTCCACTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182556    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145923.1-567s1c1
Sequence:CCGGGCGATATTGAAAGCCCTGTCACTCGAGTGACAGGGCTTTCAATATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178225    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145923.1-861s1c1
Sequence:CCGGGCAGAAGTTTGATGTCTGTCACTCGAGTGACAGACATCAAACTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145923.1-445s1c1
Sequence:CCGGGATAGAGTTGAATGACAGTATCTCGAGATACTGTCATTCAACTCTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145923.1-853s1c1
Sequence:CCGGGAAGGAGCGCAGAAGTTTGATCTCGAGATCAAACTTCTGCGCTCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145923.1-2032s1c1
Sequence:CCGGCCCTACTTCCATTGGTGTGATCTCGAGATCACACCAATGGAAGTAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085399
RELL1 MISSION shRNA Bacterial Glycerol Stock
RELT-like 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000262638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085399.1-429s21c1
Sequence:CCGGCAGTGACACTGTTGGGCAAATCTCGAGATTTGCCCAACAGTGTCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085399.1-246s21c1
Sequence:CCGGGAATGGACACCCAGAATATATCTCGAGATATATTCTGGGTGTCCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085399.1-474s21c1
Sequence:CCGGAGCGAATGCTGATGTCTTAAACTCGAGTTTAAGACATCAGCATTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085399.1-275s21c1
Sequence:CCGGCGCTTGTCCCTGTGTTCTTTACTCGAGTAAAGAACACAGGGACAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085399
RELL1 MISSION shRNA shRNA Plasmid DNA
RELT-like 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000262638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085399.1-429s21c1
Sequence:CCGGCAGTGACACTGTTGGGCAAATCTCGAGATTTGCCCAACAGTGTCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085399.1-246s21c1
Sequence:CCGGGAATGGACACCCAGAATATATCTCGAGATATATTCTGGGTGTCCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085399.1-474s21c1
Sequence:CCGGAGCGAATGCTGATGTCTTAAACTCGAGTTTAAGACATCAGCATTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000262639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085399.1-275s21c1
Sequence:CCGGCGCTTGTCCCTGTGTTCTTTACTCGAGTAAAGAACACAGGGACAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085399
RELL1 MISSION shRNA Lentiviral Transduction Particles
RELT-like 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000262638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085399.1-429s21c1
Sequence:CCGGCAGTGACACTGTTGGGCAAATCTCGAGATTTGCCCAACAGTGTCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085399.1-246s21c1
Sequence:CCGGGAATGGACACCCAGAATATATCTCGAGATATATTCTGGGTGTCCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085399.1-474s21c1
Sequence:CCGGAGCGAATGCTGATGTCTTAAACTCGAGTTTAAGACATCAGCATTCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000262639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085399.1-275s21c1
Sequence:CCGGCGCTTGTCCCTGTGTTCTTTACTCGAGTAAAGAACACAGGGACAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)