EMAIL THIS PAGE TO A FRIEND

REN

renin

46 Gene Product Result for
Synonyms: HNFJ2
UniProtKB ID: P00797, Q6FI38, Q6T5C2
Gene ID:
Human(5972) Summary: Renin catalyzes the first step in the activation pathway of angiotensinogen--a cascade that can result in aldosterone release,vasoconstriction, and increase in blood pressure. Renin, an aspartyl protease, cleaves angiotensinogen to form angiotensin I, which is converted to angiotensin II by angiotensin I converting enzyme, an important regulator of blood pressure and electrolyte balance. Transcript variants that encode different protein isoforms and that arise from alternative splicing and the use of alternative promoters have been described, but their full-length nature has not been determined. Mutations in this gene have been shown to cause familial hyperproreninemia. [provided by RefSeq, Jul 2008]
Rat(24715) renin
cow(280909) renin
fruit fly(44122) renegade
dog(403838) renin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
547905 2,2′:5′,2′′:5′′,2′′′-Quaterthiophene 96% human, mouse, rat pricing

ELISA

Product # Description Species Add to Cart
 
RAB1663 Human Renin ELISA for serum, plasma and cell culture supernatants human pricing

Kits

Product # Description Species Add to Cart
 
MAK157 Renin Assay Kit sufficient for 100 fluorometric tests human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000537 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000537 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000537 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046491 MISSION® esiRNA esiRNA human REN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000537 Rosetta Predictions human pricing
NM_012642 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191646 predicted 542
2 SASI_Hs01_00191647 predicted 1211
3 SASI_Hs01_00191648 predicted 466
4 SASI_Hs01_00191649 predicted 1229
5 SASI_Hs01_00191650 predicted 400
6 SASI_Hs01_00191651 predicted 732
7 SASI_Hs01_00191652 predicted 796
8 SASI_Hs01_00191654 predicted 795
9 SASI_Hs01_00191655 predicted 473
10 SASI_Hs02_00302755 predicted 711
11 SASI_Hs01_00191653 predicted 410
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012642 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259881 predicted 1047
2 SASI_Rn01_00094110 predicted 500
3 SASI_Rn01_00094112 predicted 1040
4 SASI_Rn01_00094113 predicted 435
5 SASI_Rn01_00094114 predicted 386
6 SASI_Rn01_00094115 predicted 1074
7 SASI_Rn02_00259882 predicted 662
8 SASI_Rn01_00094116 predicted 958
9 SASI_Rn01_00094117 predicted 399
10 SASI_Rn01_00094118 predicted 955
11 SASI_Rn01_00094109 predicted 301
12 SASI_Rn01_00094111 predicted 400
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000537
REN MISSION shRNA Bacterial Glycerol Stock
renin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000416495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000537.3-473s21c1
Sequence:CCGGAGAACTCACCCTCCGCTATTCCTCGAGGAATAGCGGAGGGTGAGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000537.3-1002s21c1
Sequence:CCGGGATTATGTCGTGAAGTGTAACCTCGAGGTTACACTTCACGACATAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000537.2-1086s1c1
Sequence:CCGGGCGGACTATGTATTTCAGGAACTCGAGTTCCTGAAATACATAGTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000537.2-1202s1c1
Sequence:CCGGCCGAAAGTTCTACACAGAGTTCTCGAGAACTCTGTGTAGAACTTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000537.2-332s1c1
Sequence:CCGGCCAAACCTTCAAAGTCGTCTTCTCGAGAAGACGACTTTGAAGGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000537.2-149s1c1
Sequence:CCGGCCTCAAGAGAATGCCCTCAATCTCGAGATTGAGGGCATTCTCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000537.2-790s1c1
Sequence:CCGGCCCAGCATTACGAAGGGAATTCTCGAGAATTCCCTTCGTAATGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000537
REN MISSION shRNA shRNA Plasmid DNA
renin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000416495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000537.3-473s21c1
Sequence:CCGGAGAACTCACCCTCCGCTATTCCTCGAGGAATAGCGGAGGGTGAGTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000537.3-1002s21c1
Sequence:CCGGGATTATGTCGTGAAGTGTAACCTCGAGGTTACACTTCACGACATAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000537.2-1086s1c1
Sequence:CCGGGCGGACTATGTATTTCAGGAACTCGAGTTCCTGAAATACATAGTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000537.2-1202s1c1
Sequence:CCGGCCGAAAGTTCTACACAGAGTTCTCGAGAACTCTGTGTAGAACTTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000537.2-332s1c1
Sequence:CCGGCCAAACCTTCAAAGTCGTCTTCTCGAGAAGACGACTTTGAAGGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000537.2-149s1c1
Sequence:CCGGCCTCAAGAGAATGCCCTCAATCTCGAGATTGAGGGCATTCTCTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000537.2-790s1c1
Sequence:CCGGCCCAGCATTACGAAGGGAATTCTCGAGAATTCCCTTCGTAATGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000537
REN MISSION shRNA Lentiviral Transduction Particles
renin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000416495    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000537.3-473s21c1
Sequence:CCGGAGAACTCACCCTCCGCTATTCCTCGAGGAATAGCGGAGGGTGAGTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000537.3-1002s21c1
Sequence:CCGGGATTATGTCGTGAAGTGTAACCTCGAGGTTACACTTCACGACATAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000537.2-1086s1c1
Sequence:CCGGGCGGACTATGTATTTCAGGAACTCGAGTTCCTGAAATACATAGTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000537.2-1202s1c1
Sequence:CCGGCCGAAAGTTCTACACAGAGTTCTCGAGAACTCTGTGTAGAACTTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000537.2-332s1c1
Sequence:CCGGCCAAACCTTCAAAGTCGTCTTCTCGAGAAGACGACTTTGAAGGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000537.2-149s1c1
Sequence:CCGGCCTCAAGAGAATGCCCTCAATCTCGAGATTGAGGGCATTCTCTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000537.2-790s1c1
Sequence:CCGGCCCAGCATTACGAAGGGAATTCTCGAGAATTCCCTTCGTAATGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)