EMAIL THIS PAGE TO A FRIEND

REP15

RAB15 effector protein

48 Gene Product Result for
Synonyms: RAB15EP
UniProtKB ID: Q6BDI9, B2RU16
Gene ID:
Human(387849) Summary: REP15 is a binding partner of the RAB GTPase family member RAB15 that facilitates transferrin receptor (TFRC; MIM 190010) recycling from the endocytic recycling compartment (Strick and Elferink, 2005 [PubMed 16195351]
Mouse(66532) RAB15 effector protein
Rat(500366) RAB15 effector protein
cow(614599) RAB15 effector protein
sheep(101110220) RAB15 effector protein
naked mole-rat(101715015) RAB15 effector protein
chicken(101668096) RAB15 effector protein
domestic cat(101082832) RAB15 effector protein
dog(100686017) RAB15 effector protein
chicken(101750755) RAB15 effector protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025620 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025620 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025620 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001029874 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029874 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029874 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029874 Rosetta Predictions human pricing
NM_001109256 Rosetta Predictions rat pricing
NM_025620 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172381 predicted 326
2 SASI_Hs01_00172382 predicted 227
3 SASI_Hs01_00172383 predicted 564
4 SASI_Hs02_00307551 predicted 495
5 SASI_Hs01_00172384 predicted 315
6 SASI_Hs02_00307552 predicted 442
7 SASI_Hs01_00172385 predicted 469
8 SASI_Hs01_00172386 predicted 227
9 SASI_Hs01_00172387 predicted 539
10 SASI_Hs01_00172388 predicted 644
11 SASI_Hs01_00172389 predicted 299
12 SASI_Hs01_00172390 predicted 519
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109256 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246624 predicted 590
2 SASI_Rn02_00246625 predicted 392
3 SASI_Rn02_00246626 predicted 587
4 SASI_Rn02_00246627 predicted 244
5 SASI_Rn02_00246628 predicted 269
6 SASI_Rn02_00246629 predicted 401
7 SASI_Rn02_00246630 predicted 738
8 SASI_Rn02_00246631 predicted 728
9 SASI_Rn02_00246632 predicted 465
10 SASI_Rn02_00246633 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025620 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00152394 predicted 536
2 SASI_Mm01_00152395 predicted 397
3 SASI_Mm01_00152396 predicted 578
4 SASI_Mm01_00152397 predicted 265
5 SASI_Mm01_00152398 predicted 294
6 SASI_Mm01_00152399 predicted 631
7 SASI_Mm01_00152400 predicted 344
8 SASI_Mm01_00152402 predicted 695
9 SASI_Mm01_00152403 predicted 281
10 SASI_Mm02_00328674 predicted 555
11 SASI_Mm01_00152401 predicted 598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025620
REP15 MISSION shRNA Bacterial Glycerol Stock
RAB15 effector protein
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025620.1-654s1c1
Sequence:CCGGGAGTGTCAGAAACGGGATGATCTCGAGATCATCCCGTTTCTGACACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025620.1-753s1c1
Sequence:CCGGGCTAGGGAACTGTCTGAGTAACTCGAGTTACTCAGACAGTTCCCTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025620.1-798s1c1
Sequence:CCGGCAGAGTTTACATCCGCATCCTCTCGAGAGGATGCGGATGTAAACTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025620.1-717s1c1
Sequence:CCGGGCTGGAAACAAAGGACTGTATCTCGAGATACAGTCCTTTGTTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025620
REP15 MISSION shRNA shRNA Plasmid DNA
RAB15 effector protein
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025620.1-654s1c1
Sequence:CCGGGAGTGTCAGAAACGGGATGATCTCGAGATCATCCCGTTTCTGACACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025620.1-753s1c1
Sequence:CCGGGCTAGGGAACTGTCTGAGTAACTCGAGTTACTCAGACAGTTCCCTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025620.1-798s1c1
Sequence:CCGGCAGAGTTTACATCCGCATCCTCTCGAGAGGATGCGGATGTAAACTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025620.1-717s1c1
Sequence:CCGGGCTGGAAACAAAGGACTGTATCTCGAGATACAGTCCTTTGTTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025620
REP15 MISSION shRNA Lentiviral Transduction Particles
RAB15 effector protein
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025620.1-654s1c1
Sequence:CCGGGAGTGTCAGAAACGGGATGATCTCGAGATCATCCCGTTTCTGACACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025620.1-753s1c1
Sequence:CCGGGCTAGGGAACTGTCTGAGTAACTCGAGTTACTCAGACAGTTCCCTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025620.1-798s1c1
Sequence:CCGGCAGAGTTTACATCCGCATCCTCTCGAGAGGATGCGGATGTAAACTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025620.1-717s1c1
Sequence:CCGGGCTGGAAACAAAGGACTGTATCTCGAGATACAGTCCTTTGTTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029874
REP15 MISSION shRNA Bacterial Glycerol Stock
RAB15 effector protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029874.1-216s1c1
Sequence:CCGGCCAGCTGCAAATACTCTGAATCTCGAGATTCAGAGTATTTGCAGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029874.1-572s1c1
Sequence:CCGGGCCAGGAAAGCCTAAAGACATCTCGAGATGTCTTTAGGCTTTCCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029874.1-165s1c1
Sequence:CCGGCAGAAACTGAAGGAGTACCTTCTCGAGAAGGTACTCCTTCAGTTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029874.1-831s1c1
Sequence:CCGGCTAATAAGCAAGCTCACCTATCTCGAGATAGGTGAGCTTGCTTATTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029874.1-682s1c1
Sequence:CCGGCTGAAGATTGTGTGTTCATCACTCGAGTGATGAACACACAATCTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029874.1-912s1c1
Sequence:CCGGCTGGGATCAAAGTACATTCATCTCGAGATGAATGTACTTTGATCCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029874.1-426s1c1
Sequence:CCGGCCTGTGGAATCTAAGCCTTGTCTCGAGACAAGGCTTAGATTCCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029874.1-545s1c1
Sequence:CCGGCCTGGGTCTGTTTATCATCTTCTCGAGAAGATGATAAACAGACCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029874.1-187s1c1
Sequence:CCGGGATTTGAATATCCTCCAAGTACTCGAGTACTTGGAGGATATTCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029874.1-854s1c1
Sequence:CCGGGCATCATTCCAGCATGGGATTCTCGAGAATCCCATGCTGGAATGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029874
REP15 MISSION shRNA shRNA Plasmid DNA
RAB15 effector protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029874.1-216s1c1
Sequence:CCGGCCAGCTGCAAATACTCTGAATCTCGAGATTCAGAGTATTTGCAGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029874.1-572s1c1
Sequence:CCGGGCCAGGAAAGCCTAAAGACATCTCGAGATGTCTTTAGGCTTTCCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029874.1-165s1c1
Sequence:CCGGCAGAAACTGAAGGAGTACCTTCTCGAGAAGGTACTCCTTCAGTTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029874.1-831s1c1
Sequence:CCGGCTAATAAGCAAGCTCACCTATCTCGAGATAGGTGAGCTTGCTTATTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029874.1-682s1c1
Sequence:CCGGCTGAAGATTGTGTGTTCATCACTCGAGTGATGAACACACAATCTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029874.1-912s1c1
Sequence:CCGGCTGGGATCAAAGTACATTCATCTCGAGATGAATGTACTTTGATCCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029874.1-426s1c1
Sequence:CCGGCCTGTGGAATCTAAGCCTTGTCTCGAGACAAGGCTTAGATTCCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029874.1-545s1c1
Sequence:CCGGCCTGGGTCTGTTTATCATCTTCTCGAGAAGATGATAAACAGACCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000121849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029874.1-187s1c1
Sequence:CCGGGATTTGAATATCCTCCAAGTACTCGAGTACTTGGAGGATATTCAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029874.1-854s1c1
Sequence:CCGGGCATCATTCCAGCATGGGATTCTCGAGAATCCCATGCTGGAATGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029874
REP15 MISSION shRNA Lentiviral Transduction Particles
RAB15 effector protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029874.1-216s1c1
Sequence:CCGGCCAGCTGCAAATACTCTGAATCTCGAGATTCAGAGTATTTGCAGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029874.1-572s1c1
Sequence:CCGGGCCAGGAAAGCCTAAAGACATCTCGAGATGTCTTTAGGCTTTCCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029874.1-165s1c1
Sequence:CCGGCAGAAACTGAAGGAGTACCTTCTCGAGAAGGTACTCCTTCAGTTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029874.1-831s1c1
Sequence:CCGGCTAATAAGCAAGCTCACCTATCTCGAGATAGGTGAGCTTGCTTATTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029874.1-682s1c1
Sequence:CCGGCTGAAGATTGTGTGTTCATCACTCGAGTGATGAACACACAATCTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029874.1-912s1c1
Sequence:CCGGCTGGGATCAAAGTACATTCATCTCGAGATGAATGTACTTTGATCCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029874.1-426s1c1
Sequence:CCGGCCTGTGGAATCTAAGCCTTGTCTCGAGACAAGGCTTAGATTCCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029874.1-545s1c1
Sequence:CCGGCCTGGGTCTGTTTATCATCTTCTCGAGAAGATGATAAACAGACCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000121849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001029874.1-187s1c1
Sequence:CCGGGATTTGAATATCCTCCAAGTACTCGAGTACTTGGAGGATATTCAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122774    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001029874.1-854s1c1
Sequence:CCGGGCATCATTCCAGCATGGGATTCTCGAGAATCCCATGCTGGAATGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)