EMAIL THIS PAGE TO A FRIEND

REPS2

RALBP1 associated Eps domain containing 2

321 Gene Product Result for
Synonyms: POB1
UniProtKB ID: Q8NFH8, A6PWZ6, O43428, Q5JNZ8, Q8NFI5
Gene ID:
Human(9185) Summary: The product of this gene is part of a protein complex that regulates the endocytosis of growth factor receptors. The encoded protein directly interacts with a GTPase activating protein that functions downstream of the small G protein Ral. Its expression can negatively affect receptor internalization and inhibit growth factor signaling. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(194590) RALBP1 associated Eps domain containing protein 2
Rat(363466) RALBP1 associated Eps domain containing 2
Domestic Rabbit(100353871) RALBP1 associated Eps domain containing 2
naked mole-rat(101707453) RALBP1 associated Eps domain containing 2
domestic guinea pig(100718277) RALBP1 associated Eps domain containing 2
cow(526887) RALBP1 associated Eps domain containing 2
sheep(101107070) RALBP1 associated Eps domain containing 2
chicken(418617) RALBP1 associated Eps domain containing 2
dog(491756) RALBP1 associated Eps domain containing 2
domestic cat(101087303) RALBP1 associated Eps domain containing 2
Horse(100056954) RALBP1 associated Eps domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004726 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178256 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178256 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178256 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080975 Rosetta Predictions human pricing
NM_004726 Rosetta Predictions human pricing
XM_001072216 Rosetta Predictions rat pricing
XM_343785 Rosetta Predictions rat pricing
NM_178256 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316237 predicted 1940
2 SASI_Hs02_00316238 predicted 1988
3 SASI_Hs02_00316239 predicted 1535
4 SASI_Hs02_00316240 predicted 1470
5 SASI_Hs02_00316241 predicted 1285
6 SASI_Hs02_00316242 predicted 1851
7 SASI_Hs02_00316243 predicted 1139
8 SASI_Hs02_00316244 predicted 2227
9 SASI_Hs02_00316245 predicted 1284
10 SASI_Hs02_00316246 predicted 1092
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041347 predicted 1948
2 SASI_Hs01_00041348 predicted 1991
3 SASI_Hs01_00041351 predicted 1536
4 SASI_Hs01_00041352 predicted 1473
5 SASI_Hs01_00041354 predicted 1290
6 SASI_Hs01_00041355 predicted 1845
7 SASI_Hs02_00338200 predicted 1145
8 SASI_Hs02_00338201 predicted 2232
9 SASI_Hs02_00338202 predicted 1294
10 SASI_Hs02_00338203 predicted 1103
11 SASI_Hs01_00041349 predicted 1123
12 SASI_Hs01_00041350 predicted 1306
13 SASI_Hs01_00041353 predicted 719
14 SASI_Hs01_00041356 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00338261 predicted 1616
2 SASI_Rn02_00338262 predicted 1589
3 SASI_Rn02_00338263 predicted 552
4 SASI_Rn02_00338264 predicted 1660
5 SASI_Rn02_00338265 predicted 1504
6 SASI_Rn02_00338266 predicted 836
7 SASI_Rn02_00338267 predicted 784
8 SASI_Rn02_00338268 predicted 1555
9 SASI_Rn02_00338269 predicted 1009
10 SASI_Rn02_00338270 predicted 1393
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343785 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396309 predicted 1587
2 SASI_Rn02_00396310 predicted 1408
3 SASI_Rn02_00396311 predicted 1505
4 SASI_Rn02_00396312 predicted 1897
5 SASI_Rn02_00396313 predicted 1482
6 SASI_Rn02_00396314 predicted 1555
7 SASI_Rn02_00396315 predicted 1611
8 SASI_Rn02_00396316 predicted 1398
9 SASI_Rn02_00396317 predicted 1551
10 SASI_Rn02_00396318 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081824 predicted 1370
2 SASI_Mm01_00081825 predicted 309
3 SASI_Mm01_00081826 predicted 709
4 SASI_Mm01_00081827 predicted 2097
5 SASI_Mm01_00081828 predicted 1425
6 SASI_Mm01_00081829 predicted 598
7 SASI_Mm01_00081830 predicted 2106
8 SASI_Mm01_00081831 predicted 904
9 SASI_Mm01_00081832 predicted 1342
10 SASI_Mm01_00081833 predicted 1154
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004726
VALIDATED
REPS2 MISSION shRNA Bacterial Glycerol Stock
RALBP1 associated Eps domain containing 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004726.1-639s1c1
Sequence:CCGGGCATGGAACTAAGGTTCAGATCTCGAGATCTGAACCTTAGTTCCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004726.1-994s1c1
Sequence:CCGGCCCTGGAGGATAACAGAAGAACTCGAGTTCTTCTGTTATCCTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004726.1-1687s1c1
Sequence:CCGGGCTACCAAGTCAGGATTGTTACTCGAGTAACAATCCTGACTTGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004726.1-2086s1c1
Sequence:CCGGGAGGTTCATCAAGAACGAATTCTCGAGAATTCGTTCTTGATGAACCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004726.1-1118s1c1
Sequence:CCGGCCATTCCAGAACTCTCCTATACTCGAGTATAGGAGAGTTCTGGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004726.2-602s21c1
Sequence:CCGGATGATGGTGAGATACGATTTGCTCGAGCAAATCGTATCTCACCATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004726.2-543s21c1
Sequence:CCGGGGTACGGATAGAGAGTATTAACTCGAGTTAATACTCTCTATCCGTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004726
VALIDATED
REPS2 MISSION shRNA shRNA Plasmid DNA
RALBP1 associated Eps domain containing 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004726.1-639s1c1
Sequence:CCGGGCATGGAACTAAGGTTCAGATCTCGAGATCTGAACCTTAGTTCCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004726.1-994s1c1
Sequence:CCGGCCCTGGAGGATAACAGAAGAACTCGAGTTCTTCTGTTATCCTCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004726.1-1687s1c1
Sequence:CCGGGCTACCAAGTCAGGATTGTTACTCGAGTAACAATCCTGACTTGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004726.1-2086s1c1
Sequence:CCGGGAGGTTCATCAAGAACGAATTCTCGAGAATTCGTTCTTGATGAACCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004726.1-1118s1c1
Sequence:CCGGCCATTCCAGAACTCTCCTATACTCGAGTATAGGAGAGTTCTGGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004726.2-602s21c1
Sequence:CCGGATGATGGTGAGATACGATTTGCTCGAGCAAATCGTATCTCACCATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004726.2-543s21c1
Sequence:CCGGGGTACGGATAGAGAGTATTAACTCGAGTTAATACTCTCTATCCGTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004726
VALIDATED
REPS2 MISSION shRNA Lentiviral Transduction Particles
RALBP1 associated Eps domain containing 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_004726.1-639s1c1
Sequence:CCGGGCATGGAACTAAGGTTCAGATCTCGAGATCTGAACCTTAGTTCCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004726.1-994s1c1
Sequence:CCGGCCCTGGAGGATAACAGAAGAACTCGAGTTCTTCTGTTATCCTCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004726.1-1687s1c1
Sequence:CCGGGCTACCAAGTCAGGATTGTTACTCGAGTAACAATCCTGACTTGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004726.1-2086s1c1
Sequence:CCGGGAGGTTCATCAAGAACGAATTCTCGAGAATTCGTTCTTGATGAACCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004726.1-1118s1c1
Sequence:CCGGCCATTCCAGAACTCTCCTATACTCGAGTATAGGAGAGTTCTGGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004726.2-602s21c1
Sequence:CCGGATGATGGTGAGATACGATTTGCTCGAGCAAATCGTATCTCACCATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423057    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004726.2-543s21c1
Sequence:CCGGGGTACGGATAGAGAGTATTAACTCGAGTTAATACTCTCTATCCGTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178256
REPS2 MISSION shRNA Bacterial Glycerol Stock
RALBP1 associated Eps domain containing 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178256.2-1258s1c1
Sequence:CCGGCGGATGGAGAAGACATCTGTTCTCGAGAACAGATGTCTTCTCCATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178256.2-1711s1c1
Sequence:CCGGCCAACAAAGATGGATGCACCACTCGAGTGGTGCATCCATCTTTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217258    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178256.3-2894s1c1
Sequence:CCGGCTAGGCCATCAACCTAGATAACTCGAGTTATCTAGGTTGATGGCCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178256.3-534s21c1
Sequence:CCGGAGGTTCAGATTCCATACTTAACTCGAGTTAAGTATGGAATCTGAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178256.3-900s21c1
Sequence:CCGGAGCGGGAGTACTACGTCAATCCTCGAGGATTGACGTAGTACTCCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178256.3-799s21c1
Sequence:CCGGTCGTCGGCAGGCATCTCTTATCTCGAGATAAGAGATGCCTGCCGACGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178256.3-428s21c1
Sequence:CCGGGTGAGAACAGAGAGTATTAAACTCGAGTTTAATACTCTCTGTTCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178256.3-5489s21c1
Sequence:CCGGATAGATTCCAGCCGCATATTCCTCGAGGAATATGCGGCTGGAATCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178256
REPS2 MISSION shRNA shRNA Plasmid DNA
RALBP1 associated Eps domain containing 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178256.2-1258s1c1
Sequence:CCGGCGGATGGAGAAGACATCTGTTCTCGAGAACAGATGTCTTCTCCATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178256.2-1711s1c1
Sequence:CCGGCCAACAAAGATGGATGCACCACTCGAGTGGTGCATCCATCTTTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217258    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178256.3-2894s1c1
Sequence:CCGGCTAGGCCATCAACCTAGATAACTCGAGTTATCTAGGTTGATGGCCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178256.3-534s21c1
Sequence:CCGGAGGTTCAGATTCCATACTTAACTCGAGTTAAGTATGGAATCTGAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178256.3-900s21c1
Sequence:CCGGAGCGGGAGTACTACGTCAATCCTCGAGGATTGACGTAGTACTCCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178256.3-799s21c1
Sequence:CCGGTCGTCGGCAGGCATCTCTTATCTCGAGATAAGAGATGCCTGCCGACGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178256.3-428s21c1
Sequence:CCGGGTGAGAACAGAGAGTATTAAACTCGAGTTTAATACTCTCTGTTCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178256.3-5489s21c1
Sequence:CCGGATAGATTCCAGCCGCATATTCCTCGAGGAATATGCGGCTGGAATCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178256
REPS2 MISSION shRNA Lentiviral Transduction Particles
RALBP1 associated Eps domain containing 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178256.2-1258s1c1
Sequence:CCGGCGGATGGAGAAGACATCTGTTCTCGAGAACAGATGTCTTCTCCATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178256.2-1711s1c1
Sequence:CCGGCCAACAAAGATGGATGCACCACTCGAGTGGTGCATCCATCTTTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217258    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178256.3-2894s1c1
Sequence:CCGGCTAGGCCATCAACCTAGATAACTCGAGTTATCTAGGTTGATGGCCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178256.3-534s21c1
Sequence:CCGGAGGTTCAGATTCCATACTTAACTCGAGTTAAGTATGGAATCTGAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178256.3-900s21c1
Sequence:CCGGAGCGGGAGTACTACGTCAATCCTCGAGGATTGACGTAGTACTCCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249384    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178256.3-799s21c1
Sequence:CCGGTCGTCGGCAGGCATCTCTTATCTCGAGATAAGAGATGCCTGCCGACGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178256.3-428s21c1
Sequence:CCGGGTGAGAACAGAGAGTATTAAACTCGAGTTTAATACTCTCTGTTCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257874    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178256.3-5489s21c1
Sequence:CCGGATAGATTCCAGCCGCATATTCCTCGAGGAATATGCGGCTGGAATCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)