EMAIL THIS PAGE TO A FRIEND

RER1

RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)

88 Gene Product Result for
UniProtKB ID: O15258, O95322
Gene ID:
Human(11079) Summary: The protein encoded by this gene is a multi-pass membrane protein that is localized to the golgi apparatus. It is involved in the retention of endoplasmic reticulum (ER) membrane proteins in the ER and retrieval of ER membrane proteins from the early Golgi compartment to facilitate gamma-secretase complex assembly. [provided by RefSeq, Oct 2009]
Mouse(67830) RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)
Rat(298675) RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)
Thale Cress(832342) protein reticulata-related 1
chicken(419397) RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)
domestic cat(101086990) RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)
dog(479578) RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)
Zebrafish(393648) RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)
cow(100125922) RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)
sheep(101103910) RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)
domestic guinea pig(100725959) RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)
naked mole-rat(101725760) RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
R4407 Anti-RER1 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution rat, human, mouse
immunofluorescence, western blot pricing
SAB2101983 Anti-RER1 antibody produced in rabbit affinity isolated antibody dog, human, guinea pig, rabbit, horse, bovine, mouse, rat
immunohistochemistry, western blot pricing
HPA051400 Anti-RER1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007033 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007033 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007033 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026395 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026395 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026395 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007033 Rosetta Predictions human pricing
NM_001039012 Rosetta Predictions rat pricing
NM_026395 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186957 predicted 952
2 SASI_Hs01_00186958 predicted 606
3 SASI_Hs01_00186959 predicted 850
4 SASI_Hs01_00186960 predicted 938
5 SASI_Hs02_00342810 predicted 821
6 SASI_Hs02_00342811 predicted 211
7 SASI_Hs01_00186963 predicted 663
8 SASI_Hs01_00186964 predicted 904
9 SASI_Hs01_00186966 predicted 945
10 SASI_Hs02_00342812 predicted 705
11 SASI_Hs01_00186961 predicted 633
12 SASI_Hs01_00186962 predicted 680
13 SASI_Hs01_00186965 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039012 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065894 predicted 806
2 SASI_Rn01_00065895 predicted 712
3 SASI_Rn01_00065896 predicted 538
4 SASI_Rn01_00065897 predicted 327
5 SASI_Rn01_00065898 predicted 555
6 SASI_Rn01_00065899 predicted 225
7 SASI_Rn01_00065900 predicted 262
8 SASI_Rn01_00065901 predicted 441
9 SASI_Rn01_00065902 predicted 218
10 SASI_Rn01_00065903 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200690 predicted 901
2 SASI_Mm01_00200691 predicted 677
3 SASI_Mm01_00200692 predicted 271
4 SASI_Mm01_00200693 predicted 374
5 SASI_Mm01_00200694 predicted 395
6 SASI_Mm01_00200695 predicted 599
7 SASI_Mm01_00200696 predicted 277
8 SASI_Mm01_00200697 predicted 583
9 SASI_Mm01_00200698 predicted 264
10 SASI_Mm01_00200699 predicted 576
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007033
VALIDATED
RER1 MISSION shRNA Bacterial Glycerol Stock
RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007033.3-337s21c1
Sequence:CCGGGCCTGAGCTTTGTCTACATGACTCGAGTCATGTAGACAAAGCTCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007033.3-680s21c1
Sequence:CCGGGAGGCAAATCAAGCACATGATCTCGAGATCATGTGCTTGATTTGCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150516    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007033.2-821s1c1
Sequence:CCGGGCCATTGTTAACAATGCCTTTCTCGAGAAAGGCATTGTTAACAATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007033.2-629s1c1
Sequence:CCGGGATTCTGGTGATGTACTTCATCTCGAGATGAAGTACATCACCAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007033.2-674s1c1
Sequence:CCGGGAGGCAAATCAAGCACATGATCTCGAGATCATGTGCTTGATTTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007033.2-981s1c1
Sequence:CCGGCGTTAAGTGTTTCTCACGGATCTCGAGATCCGTGAGAAACACTTAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007033.2-222s1c1
Sequence:CCGGGCCTGAGCTTTGTCTACATGACTCGAGTCATGTAGACAAAGCTCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007033.2-381s1c1
Sequence:CCGGCCACCAAACAGAACGAGGAATCTCGAGATTCCTCGTTCTGTTTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007033.2-665s1c1
Sequence:CCGGCACGATGAAGAGGCAAATCAACTCGAGTTGATTTGCCTCTTCATCGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007033.2-119s1c1
Sequence:CCGGCCTTCGGTGGTGTACAGATTTCTCGAGAAATCTGTACACCACCGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007033.2-952s1c1
Sequence:CCGGCCAAATCGCATGGATTTCTTTCTCGAGAAAGAAATCCATGCGATTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007033.2-155s1c1
Sequence:CCGGCAGATTTATCAGTCCTGGCTACTCGAGTAGCCAGGACTGATAAATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007033.3-635s21c1
Sequence:CCGGGATTCTGGTGATGTACTTCATCTCGAGATGAAGTACATCACCAGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007033.3-671s21c1
Sequence:CCGGCACGATGAAGAGGCAAATCAACTCGAGTTGATTTGCCTCTTCATCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007033
VALIDATED
RER1 MISSION shRNA shRNA Plasmid DNA
RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007033.3-337s21c1
Sequence:CCGGGCCTGAGCTTTGTCTACATGACTCGAGTCATGTAGACAAAGCTCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007033.3-680s21c1
Sequence:CCGGGAGGCAAATCAAGCACATGATCTCGAGATCATGTGCTTGATTTGCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150516    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007033.2-821s1c1
Sequence:CCGGGCCATTGTTAACAATGCCTTTCTCGAGAAAGGCATTGTTAACAATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007033.2-629s1c1
Sequence:CCGGGATTCTGGTGATGTACTTCATCTCGAGATGAAGTACATCACCAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007033.2-674s1c1
Sequence:CCGGGAGGCAAATCAAGCACATGATCTCGAGATCATGTGCTTGATTTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007033.2-981s1c1
Sequence:CCGGCGTTAAGTGTTTCTCACGGATCTCGAGATCCGTGAGAAACACTTAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007033.2-222s1c1
Sequence:CCGGGCCTGAGCTTTGTCTACATGACTCGAGTCATGTAGACAAAGCTCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007033.2-381s1c1
Sequence:CCGGCCACCAAACAGAACGAGGAATCTCGAGATTCCTCGTTCTGTTTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007033.2-665s1c1
Sequence:CCGGCACGATGAAGAGGCAAATCAACTCGAGTTGATTTGCCTCTTCATCGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007033.2-119s1c1
Sequence:CCGGCCTTCGGTGGTGTACAGATTTCTCGAGAAATCTGTACACCACCGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007033.2-952s1c1
Sequence:CCGGCCAAATCGCATGGATTTCTTTCTCGAGAAAGAAATCCATGCGATTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007033.2-155s1c1
Sequence:CCGGCAGATTTATCAGTCCTGGCTACTCGAGTAGCCAGGACTGATAAATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007033.3-635s21c1
Sequence:CCGGGATTCTGGTGATGTACTTCATCTCGAGATGAAGTACATCACCAGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007033.3-671s21c1
Sequence:CCGGCACGATGAAGAGGCAAATCAACTCGAGTTGATTTGCCTCTTCATCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007033
VALIDATED
RER1 MISSION shRNA Lentiviral Transduction Particles
RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007033.3-337s21c1
Sequence:CCGGGCCTGAGCTTTGTCTACATGACTCGAGTCATGTAGACAAAGCTCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007033.3-680s21c1
Sequence:CCGGGAGGCAAATCAAGCACATGATCTCGAGATCATGTGCTTGATTTGCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150516    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007033.2-821s1c1
Sequence:CCGGGCCATTGTTAACAATGCCTTTCTCGAGAAAGGCATTGTTAACAATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007033.2-629s1c1
Sequence:CCGGGATTCTGGTGATGTACTTCATCTCGAGATGAAGTACATCACCAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007033.2-674s1c1
Sequence:CCGGGAGGCAAATCAAGCACATGATCTCGAGATCATGTGCTTGATTTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153869    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007033.2-981s1c1
Sequence:CCGGCGTTAAGTGTTTCTCACGGATCTCGAGATCCGTGAGAAACACTTAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007033.2-222s1c1
Sequence:CCGGGCCTGAGCTTTGTCTACATGACTCGAGTCATGTAGACAAAGCTCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007033.2-381s1c1
Sequence:CCGGCCACCAAACAGAACGAGGAATCTCGAGATTCCTCGTTCTGTTTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007033.2-665s1c1
Sequence:CCGGCACGATGAAGAGGCAAATCAACTCGAGTTGATTTGCCTCTTCATCGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157289    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007033.2-119s1c1
Sequence:CCGGCCTTCGGTGGTGTACAGATTTCTCGAGAAATCTGTACACCACCGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007033.2-952s1c1
Sequence:CCGGCCAAATCGCATGGATTTCTTTCTCGAGAAAGAAATCCATGCGATTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007033.2-155s1c1
Sequence:CCGGCAGATTTATCAGTCCTGGCTACTCGAGTAGCCAGGACTGATAAATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007033.3-635s21c1
Sequence:CCGGGATTCTGGTGATGTACTTCATCTCGAGATGAAGTACATCACCAGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007033.3-671s21c1
Sequence:CCGGCACGATGAAGAGGCAAATCAACTCGAGTTGATTTGCCTCTTCATCGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026395
VALIDATED
RER1 MISSION shRNA Bacterial Glycerol Stock
RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026395.1-143s21c1
Sequence:CCGGCCCTCGGTGGTGTACAGATTTCTCGAGAAATCTGTACACCACCGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026395.1-277s21c1
Sequence:CCGGCCTGTTACAAGGTTGGTACATCTCGAGATGTACCAACCTTGTAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026395.1-1071s21c1
Sequence:CCGGGTACCGCTTTGAGGGTGATTTCTCGAGAAATCACCCTCAAAGCGGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026395.1-167s21c1
Sequence:CCGGTCACGGCTTGGACAGATTTATCTCGAGATAAATCTGTCCAAGCCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026395.1-309s1c1
Sequence:CCGGCCTTGGGAATTTACCACCTAACTCGAGTTAGGTGGTAAATTCCCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026395.1-277s1c1
Sequence:CCGGCCTGTTACAAGGTTGGTACATCTCGAGATGTACCAACCTTGTAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026395.1-606s21c1
Sequence:CCGGTGATTAAATACCGGTACATACCTCGAGGTATGTACCGGTATTTAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026395.1-404s1c1
Sequence:CCGGCCAACCAAACAGAATGAGGAACTCGAGTTCCTCATTCTGTTTGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026395.1-310s1c1
Sequence:CCGGCTTGGGAATTTACCACCTAAACTCGAGTTTAGGTGGTAAATTCCCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026395.1-1161s1c1
Sequence:CCGGCCTCGATCATAATGACTCAAACTCGAGTTTGAGTCATTATGATCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026395
VALIDATED
RER1 MISSION shRNA shRNA Plasmid DNA
RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026395.1-143s21c1
Sequence:CCGGCCCTCGGTGGTGTACAGATTTCTCGAGAAATCTGTACACCACCGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000287592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026395.1-277s21c1
Sequence:CCGGCCTGTTACAAGGTTGGTACATCTCGAGATGTACCAACCTTGTAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026395.1-1071s21c1
Sequence:CCGGGTACCGCTTTGAGGGTGATTTCTCGAGAAATCACCCTCAAAGCGGTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000307485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026395.1-167s21c1
Sequence:CCGGTCACGGCTTGGACAGATTTATCTCGAGATAAATCTGTCCAAGCCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026395.1-309s1c1
Sequence:CCGGCCTTGGGAATTTACCACCTAACTCGAGTTAGGTGGTAAATTCCCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026395.1-277s1c1
Sequence:CCGGCCTGTTACAAGGTTGGTACATCTCGAGATGTACCAACCTTGTAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026395.1-606s21c1
Sequence:CCGGTGATTAAATACCGGTACATACCTCGAGGTATGTACCGGTATTTAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026395.1-404s1c1
Sequence:CCGGCCAACCAAACAGAATGAGGAACTCGAGTTCCTCATTCTGTTTGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026395.1-310s1c1
Sequence:CCGGCTTGGGAATTTACCACCTAAACTCGAGTTTAGGTGGTAAATTCCCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026395.1-1161s1c1
Sequence:CCGGCCTCGATCATAATGACTCAAACTCGAGTTTGAGTCATTATGATCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026395
VALIDATED
RER1 MISSION shRNA Lentiviral Transduction Particles
RER1 retention in endoplasmic reticulum 1 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026395.1-143s21c1
Sequence:CCGGCCCTCGGTGGTGTACAGATTTCTCGAGAAATCTGTACACCACCGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000287592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026395.1-277s21c1
Sequence:CCGGCCTGTTACAAGGTTGGTACATCTCGAGATGTACCAACCTTGTAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026395.1-1071s21c1
Sequence:CCGGGTACCGCTTTGAGGGTGATTTCTCGAGAAATCACCCTCAAAGCGGTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000307485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026395.1-167s21c1
Sequence:CCGGTCACGGCTTGGACAGATTTATCTCGAGATAAATCTGTCCAAGCCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026395.1-309s1c1
Sequence:CCGGCCTTGGGAATTTACCACCTAACTCGAGTTAGGTGGTAAATTCCCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026395.1-277s1c1
Sequence:CCGGCCTGTTACAAGGTTGGTACATCTCGAGATGTACCAACCTTGTAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026395.1-606s21c1
Sequence:CCGGTGATTAAATACCGGTACATACCTCGAGGTATGTACCGGTATTTAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026395.1-404s1c1
Sequence:CCGGCCAACCAAACAGAATGAGGAACTCGAGTTCCTCATTCTGTTTGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026395.1-310s1c1
Sequence:CCGGCTTGGGAATTTACCACCTAAACTCGAGTTTAGGTGGTAAATTCCCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119847    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026395.1-1161s1c1
Sequence:CCGGCCTCGATCATAATGACTCAAACTCGAGTTTGAGTCATTATGATCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)