EMAIL THIS PAGE TO A FRIEND

RERE

arginine-glutamic acid dipeptide (RE) repeats

167 Gene Product Result for
Synonyms: ARG ARP ATN1L DNB1
Gene ID:
Human(473) Summary: This gene encodes a member of the atrophin family of arginine-glutamic acid (RE) dipeptide repeat-containing proteins. The encoded protein co-localizes with a transcription factor in the nucleus, and its overexpression triggers apoptosis. A similar protein in mouse associates with histone deacetylase and is thought to function as a transcriptional co-repressor during embryonic development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(68703) arginine glutamic acid dipeptide (RE) repeats
Rat(116665) arginine-glutamic acid dipeptide (RE) repeats
chicken(419435) arginine-glutamic acid dipeptide (RE) repeats
domestic cat(101096821) arginine-glutamic acid dipeptide (RE) repeats
Horse(100051942) arginine-glutamic acid dipeptide (RE) repeats
dog(479596) arginine-glutamic acid dipeptide (RE) repeats
naked mole-rat(101719915) arginine-glutamic acid dipeptide (RE) repeats
domestic guinea pig(100721896) arginine-glutamic acid dipeptide (RE) repeats
cow(535394) arginine-glutamic acid dipeptide (RE) repeats
sheep(101114630) arginine-glutamic acid dipeptide (RE) repeats
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012102 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012102 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012102 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001085492 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085492 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085492 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082401 MISSION® esiRNA esiRNA human RERE (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042681 Rosetta Predictions human pricing
NM_001042682 Rosetta Predictions human pricing
NM_012102 Rosetta Predictions human pricing
NM_053885 Rosetta Predictions rat pricing
NM_001085492 Rosetta Predictions mouse pricing
XM_001003618 Rosetta Predictions mouse pricing
XM_204015 Rosetta Predictions mouse pricing
XM_902353 Rosetta Predictions mouse pricing
XM_902355 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310953 predicted 2281
2 SASI_Hs02_00310954 predicted 5276
3 SASI_Hs02_00310955 predicted 5306
4 SASI_Hs02_00310956 predicted 5477
5 SASI_Hs02_00310957 predicted 5244
6 SASI_Hs02_00310958 predicted 2054
7 SASI_Hs02_00310959 predicted 5266
8 SASI_Hs02_00310960 predicted 2478
9 SASI_Hs02_00310961 predicted 2504
10 SASI_Hs02_00310962 predicted 2661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310963 predicted 3569
2 SASI_Hs02_00310964 predicted 700
3 SASI_Hs02_00310965 predicted 986
4 SASI_Hs02_00310966 predicted 3562
5 SASI_Hs02_00310967 predicted 1079
6 SASI_Hs02_00310968 predicted 2701
7 SASI_Hs02_00310969 predicted 3540
8 SASI_Hs02_00310970 predicted 3563
9 SASI_Hs02_00310971 predicted 782
10 SASI_Hs02_00310972 predicted 800
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012102 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189989 predicted 2461
2 SASI_Hs01_00189994 predicted 5459
3 SASI_Hs02_00343621 predicted 5488
4 SASI_Hs02_00343622 predicted 5665
5 SASI_Hs01_00189996 predicted 5432
6 SASI_Hs02_00343623 predicted 2246
7 SASI_Hs02_00343624 predicted 5442
8 SASI_Hs02_00343625 predicted 2667
9 SASI_Hs02_00343626 predicted 2685
10 SASI_Hs02_00343627 predicted 2844
11 SASI_Hs01_00189988 predicted 1328
12 SASI_Hs01_00189990 predicted 1205
13 SASI_Hs01_00189991 predicted 1494
14 SASI_Hs01_00189992 predicted 1831
15 SASI_Hs01_00189993 predicted 1552
16 SASI_Hs01_00189995 predicted 1272
17 SASI_Hs01_00189997 predicted 1660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266795 predicted 1260
2 SASI_Rn02_00266796 predicted 1476
3 SASI_Rn02_00266797 predicted 1145
4 SASI_Rn02_00266798 predicted 1125
5 SASI_Rn02_00266799 predicted 1860
6 SASI_Rn02_00266800 predicted 1687
7 SASI_Rn02_00266801 predicted 1773
8 SASI_Rn02_00266802 predicted 1940
9 SASI_Rn02_00266803 predicted 2455
10 SASI_Rn02_00266804 predicted 1671
11 SASI_Rn01_00061322 predicted 3272
12 SASI_Rn01_00061323 predicted 6055
13 SASI_Rn01_00061324 predicted 6163
14 SASI_Rn01_00061325 predicted 6152
15 SASI_Rn01_00061326 predicted 6164
16 SASI_Rn01_00061327 predicted 6153
17 SASI_Rn01_00061328 predicted 6163
18 SASI_Rn01_00061329 predicted 5996
19 SASI_Rn01_00061330 predicted 3399
20 SASI_Rn01_00061331 predicted 3840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085492 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300522 predicted 992
2 SASI_Mm02_00300523 predicted 1591
3 SASI_Mm02_00300524 predicted 1419
4 SASI_Mm02_00300525 predicted 853
5 SASI_Mm02_00300526 predicted 1501
6 SASI_Mm02_00300527 predicted 4531
7 SASI_Mm02_00300528 predicted 2319
8 SASI_Mm02_00300529 predicted 5071
9 SASI_Mm02_00300530 predicted 1401
10 SASI_Mm02_00300531 predicted 5065
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001003618 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271854 predicted 709
2 SASI_Mm01_00271855 predicted 4046
3 SASI_Mm01_00271856 predicted 541
4 SASI_Mm01_00271857 predicted 620
5 SASI_Mm01_00271858 predicted 721
6 SASI_Mm01_00271859 predicted 3651
7 SASI_Mm01_00271860 predicted 1438
8 SASI_Mm01_00271861 predicted 4196
9 SASI_Mm01_00271862 predicted 525
10 SASI_Mm01_00271863 predicted 4189
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_204015 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00240573 predicted 691
2 SASI_Mm01_00240574 predicted 1284
3 SASI_Mm01_00240575 predicted 4625
4 SASI_Mm01_00240576 predicted 1112
5 SASI_Mm01_00240577 predicted 562
6 SASI_Mm01_00240578 predicted 1193
7 SASI_Mm01_00240579 predicted 4226
8 SASI_Mm01_00240580 predicted 2018
9 SASI_Mm01_00240581 predicted 1106
10 SASI_Mm01_00240582 predicted 4762
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902353 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00283704 predicted 1073
2 SASI_Mm01_00283705 predicted 2709
3 SASI_Mm01_00283706 predicted 3583
4 SASI_Mm01_00283707 predicted 3747
5 SASI_Mm01_00283708 predicted 2586
6 SASI_Mm01_00283709 predicted 3192
7 SASI_Mm01_00283710 predicted 988
8 SASI_Mm01_00283711 predicted 3726
9 SASI_Mm01_00283712 predicted 831
10 SASI_Mm01_00283713 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902355 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204197 predicted 1029
2 SASI_Mm01_00204198 predicted 3551
3 SASI_Mm01_00204199 predicted 3698
4 SASI_Mm01_00204200 predicted 3151
5 SASI_Mm01_00204201 predicted 937
6 SASI_Mm01_00204202 predicted 3696
7 SASI_Mm01_00204203 predicted 3693
8 SASI_Mm01_00204204 predicted 781
9 SASI_Mm01_00204205 predicted 799
10 SASI_Mm01_00204206 predicted 595
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012102
VALIDATED
RERE MISSION shRNA Bacterial Glycerol Stock
arginine-glutamic acid dipeptide (RE) repeats
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012102.2-4020s1c1
Sequence:CCGGCCAGTCAGCTAGGTTCTACAACTCGAGTTGTAGAACCTAGCTGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012102.2-2287s1c1
Sequence:CCGGCCGCCACCGTTTATGTTCAAACTCGAGTTTGAACATAAACGGTGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_012102.2-997s1c1
Sequence:CCGGCCGTATTTCATCTGTAGCATTCTCGAGAATGCTACAGATGAAATACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_012102.2-1504s1c1
Sequence:CCGGCCTAGTCATCAGGCCAAACTTCTCGAGAAGTTTGGCCTGATGACTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012102.2-7603s1c1
Sequence:CCGGCGGCTGAGATTCTTCCATCTACTCGAGTAGATGGAAGAATCTCAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012102.3-5938s21c1
Sequence:CCGGTGGAATCCAAGAGCTATAATTCTCGAGAATTATAGCTCTTGGATTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012102.3-2102s21c1
Sequence:CCGGTGATCACCTTCTATTACTATTCTCGAGAATAGTAATAGAAGGTGATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012102.3-4194s21c1
Sequence:CCGGCCAGTCAGCTAGGTTCTACAACTCGAGTTGTAGAACCTAGCTGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012102.3-1411s21c1
Sequence:CCGGTTGGTTCAGGATCGACATAATCTCGAGATTATGTCGATCCTGAACCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012102.3-2179s21c1
Sequence:CCGGGCCGTGTTCAGGAGGATTAAGCTCGAGCTTAATCCTCCTGAACACGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012102
VALIDATED
RERE MISSION shRNA shRNA Plasmid DNA
arginine-glutamic acid dipeptide (RE) repeats
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012102.2-4020s1c1
Sequence:CCGGCCAGTCAGCTAGGTTCTACAACTCGAGTTGTAGAACCTAGCTGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012102.2-2287s1c1
Sequence:CCGGCCGCCACCGTTTATGTTCAAACTCGAGTTTGAACATAAACGGTGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_012102.2-997s1c1
Sequence:CCGGCCGTATTTCATCTGTAGCATTCTCGAGAATGCTACAGATGAAATACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_012102.2-1504s1c1
Sequence:CCGGCCTAGTCATCAGGCCAAACTTCTCGAGAAGTTTGGCCTGATGACTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012102.2-7603s1c1
Sequence:CCGGCGGCTGAGATTCTTCCATCTACTCGAGTAGATGGAAGAATCTCAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012102.3-5938s21c1
Sequence:CCGGTGGAATCCAAGAGCTATAATTCTCGAGAATTATAGCTCTTGGATTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012102.3-2102s21c1
Sequence:CCGGTGATCACCTTCTATTACTATTCTCGAGAATAGTAATAGAAGGTGATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012102.3-4194s21c1
Sequence:CCGGCCAGTCAGCTAGGTTCTACAACTCGAGTTGTAGAACCTAGCTGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012102.3-1411s21c1
Sequence:CCGGTTGGTTCAGGATCGACATAATCTCGAGATTATGTCGATCCTGAACCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000329700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012102.3-2179s21c1
Sequence:CCGGGCCGTGTTCAGGAGGATTAAGCTCGAGCTTAATCCTCCTGAACACGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012102
VALIDATED
RERE MISSION shRNA Lentiviral Transduction Particles
arginine-glutamic acid dipeptide (RE) repeats
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_012102.2-4020s1c1
Sequence:CCGGCCAGTCAGCTAGGTTCTACAACTCGAGTTGTAGAACCTAGCTGACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012102.2-2287s1c1
Sequence:CCGGCCGCCACCGTTTATGTTCAAACTCGAGTTTGAACATAAACGGTGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_012102.2-997s1c1
Sequence:CCGGCCGTATTTCATCTGTAGCATTCTCGAGAATGCTACAGATGAAATACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_012102.2-1504s1c1
Sequence:CCGGCCTAGTCATCAGGCCAAACTTCTCGAGAAGTTTGGCCTGATGACTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012102.2-7603s1c1
Sequence:CCGGCGGCTGAGATTCTTCCATCTACTCGAGTAGATGGAAGAATCTCAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353623    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012102.3-5938s21c1
Sequence:CCGGTGGAATCCAAGAGCTATAATTCTCGAGAATTATAGCTCTTGGATTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012102.3-2102s21c1
Sequence:CCGGTGATCACCTTCTATTACTATTCTCGAGAATAGTAATAGAAGGTGATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012102.3-4194s21c1
Sequence:CCGGCCAGTCAGCTAGGTTCTACAACTCGAGTTGTAGAACCTAGCTGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012102.3-1411s21c1
Sequence:CCGGTTGGTTCAGGATCGACATAATCTCGAGATTATGTCGATCCTGAACCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000329700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012102.3-2179s21c1
Sequence:CCGGGCCGTGTTCAGGAGGATTAAGCTCGAGCTTAATCCTCCTGAACACGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085492
RERE MISSION shRNA Bacterial Glycerol Stock
arginine-glutamic acid dipeptide (RE) repeats
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085492.1-4923s21c1
Sequence:CCGGTGCCAAGTCAGGAGGATTATTCTCGAGAATAATCCTCCTGACTTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085492.1-840s21c1
Sequence:CCGGATCTACTCATGAACGTCAAATCTCGAGATTTGACGTTCATGAGTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085492.1-5534s21c1
Sequence:CCGGGACGACTATTCTGATCTATTTCTCGAGAAATAGATCAGAATAGTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085492.1-652s21c1
Sequence:CCGGGCGGCCAAACACACCGTATTTCTCGAGAAATACGGTGTGTTTGGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085492.1-4038s21c1
Sequence:CCGGTCCGGACACTGAGCGAATATGCTCGAGCATATTCGCTCAGTGTCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085492
RERE MISSION shRNA shRNA Plasmid DNA
arginine-glutamic acid dipeptide (RE) repeats
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085492.1-4923s21c1
Sequence:CCGGTGCCAAGTCAGGAGGATTATTCTCGAGAATAATCCTCCTGACTTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085492.1-840s21c1
Sequence:CCGGATCTACTCATGAACGTCAAATCTCGAGATTTGACGTTCATGAGTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085492.1-5534s21c1
Sequence:CCGGGACGACTATTCTGATCTATTTCTCGAGAAATAGATCAGAATAGTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085492.1-652s21c1
Sequence:CCGGGCGGCCAAACACACCGTATTTCTCGAGAAATACGGTGTGTTTGGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085492.1-4038s21c1
Sequence:CCGGTCCGGACACTGAGCGAATATGCTCGAGCATATTCGCTCAGTGTCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085492
RERE MISSION shRNA Lentiviral Transduction Particles
arginine-glutamic acid dipeptide (RE) repeats
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085492.1-4923s21c1
Sequence:CCGGTGCCAAGTCAGGAGGATTATTCTCGAGAATAATCCTCCTGACTTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238709    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085492.1-840s21c1
Sequence:CCGGATCTACTCATGAACGTCAAATCTCGAGATTTGACGTTCATGAGTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238708    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085492.1-5534s21c1
Sequence:CCGGGACGACTATTCTGATCTATTTCTCGAGAAATAGATCAGAATAGTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085492.1-652s21c1
Sequence:CCGGGCGGCCAAACACACCGTATTTCTCGAGAAATACGGTGTGTTTGGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085492.1-4038s21c1
Sequence:CCGGTCCGGACACTGAGCGAATATGCTCGAGCATATTCGCTCAGTGTCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)