EMAIL THIS PAGE TO A FRIEND

RERG

RAS-like, estrogen-regulated, growth inhibitor

103 Gene Product Result for
UniProtKB ID: Q96A58, B2R9R0, B4DI02
Gene ID:
Human(85004) Summary: RERG, a member of the RAS superfamily of GTPases, inhibits cell proliferation and tumor formation (Finlin et al., 2001 [PubMed 11533059]
Mouse(232441) RAS-like, estrogen-regulated, growth-inhibitor
Rat(502916) RAS-like, estrogen-regulated, growth-inhibitor
chicken(418173) RAS-like, estrogen-regulated, growth inhibitor
domestic cat(101097741) RAS-like, estrogen-regulated, growth inhibitor
dog(486665) RAS-like, estrogen-regulated, growth inhibitor
cow(540025) RAS-like, estrogen-regulated, growth inhibitor
Goat(100861243) RAS-like, estrogen-regulated, growth inhibitor
sheep(101105402) RAS-like, estrogen-regulated, growth inhibitor
domestic guinea pig(100714399) RAS-like, estrogen-regulated, growth inhibitor
naked mole-rat(101716934) RAS-like, estrogen-regulated, growth inhibitor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032918 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181988 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181988 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181988 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032918 Rosetta Predictions human pricing
XM_001072746 Rosetta Predictions rat pricing
XM_578417 Rosetta Predictions rat pricing
NM_181988 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052699 predicted 1149
2 SASI_Hs01_00052700 predicted 1115
3 SASI_Hs02_00360531 predicted 1068
4 SASI_Hs01_00052702 predicted 1097
5 SASI_Hs01_00052703 predicted 1017
6 SASI_Hs01_00052705 predicted 999
7 SASI_Hs01_00052706 predicted 350
8 SASI_Hs01_00052707 predicted 1050
9 SASI_Hs02_00360532 predicted 1183
10 SASI_Hs02_00360533 predicted 1127
11 SASI_Hs01_00052698 predicted 907
12 SASI_Hs01_00052701 predicted 576
13 SASI_Hs01_00052704 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072746 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00340365 predicted 853
2 SASI_Rn02_00340366 predicted 756
3 SASI_Rn02_00340367 predicted 659
4 SASI_Rn02_00340368 predicted 699
5 SASI_Rn02_00340369 predicted 531
6 SASI_Rn02_00340370 predicted 980
7 SASI_Rn02_00340371 predicted 665
8 SASI_Rn02_00340372 predicted 1010
9 SASI_Rn02_00340373 predicted 1041
10 SASI_Rn02_00340374 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578417 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407855 predicted 848
2 SASI_Rn02_00407856 predicted 758
3 SASI_Rn02_00407857 predicted 659
4 SASI_Rn02_00407858 predicted 695
5 SASI_Rn02_00407859 predicted 531
6 SASI_Rn02_00407860 predicted 978
7 SASI_Rn02_00407861 predicted 661
8 SASI_Rn02_00407862 predicted 1013
9 SASI_Rn02_00407863 predicted 1040
10 SASI_Rn02_00407864 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181988 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027813 predicted 722
2 SASI_Mm02_00349947 predicted 465
3 SASI_Mm01_00027814 predicted 589
4 SASI_Mm01_00027815 predicted 644
5 SASI_Mm01_00027816 predicted 842
6 SASI_Mm01_00027818 predicted 639
7 SASI_Mm01_00027819 predicted 314
8 SASI_Mm01_00027820 predicted 909
9 SASI_Mm01_00027821 predicted 252
10 SASI_Mm01_00027822 predicted 373
11 SASI_Mm01_00027817 predicted 588
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032918
RERG MISSION shRNA Bacterial Glycerol Stock
RAS-like, estrogen-regulated, growth inhibitor
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032918.1-434s21c1
Sequence:CCGGCATCGATGATGAAGTTGTTTCCTCGAGGAAACAACTTCATCATCGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032918.1-841s1c1
Sequence:CCGGCGCATGTCAAGCAAGCCATTACTCGAGTAATGGCTTGCTTGACATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032918.1-700s1c1
Sequence:CCGGCCACAGAATTGGCTTGTGCTTCTCGAGAAGCACAAGCCAATTCTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032918.1-579s1c1
Sequence:CCGGCCACTTAAGAACATCCTAGATCTCGAGATCTAGGATGTTCTTAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032918.1-378s1c1
Sequence:CCGGCGGTTCATCTGGGAATATGATCTCGAGATCATATTCCCAGATGAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032918.1-357s1c1
Sequence:CCGGGTAGTGAGATTTCTGACCAAACTCGAGTTTGGTCAGAAATCTCACTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032918.1-1010s21c1
Sequence:CCGCATTGTTTCTGGCCTCTAATAGCTCGAGCTATTAGAGGCCAGAAACAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032918
RERG MISSION shRNA shRNA Plasmid DNA
RAS-like, estrogen-regulated, growth inhibitor
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032918.1-434s21c1
Sequence:CCGGCATCGATGATGAAGTTGTTTCCTCGAGGAAACAACTTCATCATCGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032918.1-841s1c1
Sequence:CCGGCGCATGTCAAGCAAGCCATTACTCGAGTAATGGCTTGCTTGACATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032918.1-700s1c1
Sequence:CCGGCCACAGAATTGGCTTGTGCTTCTCGAGAAGCACAAGCCAATTCTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032918.1-579s1c1
Sequence:CCGGCCACTTAAGAACATCCTAGATCTCGAGATCTAGGATGTTCTTAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032918.1-378s1c1
Sequence:CCGGCGGTTCATCTGGGAATATGATCTCGAGATCATATTCCCAGATGAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032918.1-357s1c1
Sequence:CCGGGTAGTGAGATTTCTGACCAAACTCGAGTTTGGTCAGAAATCTCACTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032918.1-1010s21c1
Sequence:CCGCATTGTTTCTGGCCTCTAATAGCTCGAGCTATTAGAGGCCAGAAACAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032918
RERG MISSION shRNA Lentiviral Transduction Particles
RAS-like, estrogen-regulated, growth inhibitor
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032918.1-434s21c1
Sequence:CCGGCATCGATGATGAAGTTGTTTCCTCGAGGAAACAACTTCATCATCGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047398    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032918.1-841s1c1
Sequence:CCGGCGCATGTCAAGCAAGCCATTACTCGAGTAATGGCTTGCTTGACATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032918.1-700s1c1
Sequence:CCGGCCACAGAATTGGCTTGTGCTTCTCGAGAAGCACAAGCCAATTCTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032918.1-579s1c1
Sequence:CCGGCCACTTAAGAACATCCTAGATCTCGAGATCTAGGATGTTCTTAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032918.1-378s1c1
Sequence:CCGGCGGTTCATCTGGGAATATGATCTCGAGATCATATTCCCAGATGAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032918.1-357s1c1
Sequence:CCGGGTAGTGAGATTTCTGACCAAACTCGAGTTTGGTCAGAAATCTCACTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431021    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032918.1-1010s21c1
Sequence:CCGCATTGTTTCTGGCCTCTAATAGCTCGAGCTATTAGAGGCCAGAAACAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181988
RERG MISSION shRNA Bacterial Glycerol Stock
RAS-like, estrogen-regulated, growth inhibitor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181988.1-322s1c1
Sequence:CCGGCCATAGACGATGAAGTTGTTTCTCGAGAAACAACTTCATCGTCTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181988.1-318s1c1
Sequence:CCGGGCAACCATAGACGATGAAGTTCTCGAGAACTTCATCGTCTATGGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181988.1-920s1c1
Sequence:CCGGGCTGGGAAATTCTCTGAGTATCTCGAGATACTCAGAGAATTTCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181988.1-734s1c1
Sequence:CCGGCGTCAAGCAAGCGATTAACAACTCGAGTTGTTAATCGCTTGCTTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181988.1-468s1c1
Sequence:CCGGCCGCTGAAGAACATCTTAGATCTCGAGATCTAAGATGTTCTTCAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181988
RERG MISSION shRNA shRNA Plasmid DNA
RAS-like, estrogen-regulated, growth inhibitor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181988.1-322s1c1
Sequence:CCGGCCATAGACGATGAAGTTGTTTCTCGAGAAACAACTTCATCGTCTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181988.1-318s1c1
Sequence:CCGGGCAACCATAGACGATGAAGTTCTCGAGAACTTCATCGTCTATGGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181988.1-920s1c1
Sequence:CCGGGCTGGGAAATTCTCTGAGTATCTCGAGATACTCAGAGAATTTCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181988.1-734s1c1
Sequence:CCGGCGTCAAGCAAGCGATTAACAACTCGAGTTGTTAATCGCTTGCTTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181988.1-468s1c1
Sequence:CCGGCCGCTGAAGAACATCTTAGATCTCGAGATCTAAGATGTTCTTCAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181988
RERG MISSION shRNA Lentiviral Transduction Particles
RAS-like, estrogen-regulated, growth inhibitor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181988.1-322s1c1
Sequence:CCGGCCATAGACGATGAAGTTGTTTCTCGAGAAACAACTTCATCGTCTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181988.1-318s1c1
Sequence:CCGGGCAACCATAGACGATGAAGTTCTCGAGAACTTCATCGTCTATGGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102690    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181988.1-920s1c1
Sequence:CCGGGCTGGGAAATTCTCTGAGTATCTCGAGATACTCAGAGAATTTCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181988.1-734s1c1
Sequence:CCGGCGTCAAGCAAGCGATTAACAACTCGAGTTGTTAATCGCTTGCTTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181988.1-468s1c1
Sequence:CCGGCCGCTGAAGAACATCTTAGATCTCGAGATCTAAGATGTTCTTCAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)