EMAIL THIS PAGE TO A FRIEND

RESP18

regulated endocrine-specific protein 18

73 Gene Product Result for
UniProtKB ID: Q5W5W9, A8MQ49, Q38I23, Q5W5X0
Gene ID:
Mouse(19711) regulated endocrine-specific protein 18
Rat(50561) regulated endocrine-specific protein 18
domestic cat(101100906) regulated endocrine-specific protein 18 homolog (rat)
cow(510410) regulated endocrine-specific protein 18 homolog (rat)
sheep(101116806) regulated endocrine-specific protein 18 homolog (rat)
domestic guinea pig(101788503) regulated endocrine-specific protein 18
naked mole-rat(101717626) regulated endocrine-specific protein 18
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009049 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009049 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009049 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001007089 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007089 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007089 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU122421 MISSION® esiRNA esiRNA human RESP18 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007089 Rosetta Predictions human pricing
XR_040175 Rosetta Predictions human pricing
XR_040176 Rosetta Predictions human pricing
XR_040177 Rosetta Predictions human pricing
NM_019278 Rosetta Predictions rat pricing
NM_009049 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007089 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210866 predicted 413
2 SASI_Hs01_00210867 predicted 416
3 SASI_Hs01_00210868 predicted 423
4 SASI_Hs01_00210869 predicted 424
5 SASI_Hs01_00210870 predicted 416
6 SASI_Hs01_00210871 predicted 372
7 SASI_Hs01_00210872 predicted 378
8 SASI_Hs01_00210873 predicted 425
9 SASI_Hs01_00210874 predicted 408
10 SASI_Hs01_00210875 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516604 predicted 304
2 SASI_Hs02_00516605 predicted 333
3 SASI_Hs02_00516606 predicted 291
4 SASI_Hs02_00516607 predicted 540
5 SASI_Hs02_00516608 predicted 223
6 SASI_Hs02_00516609 predicted 221
7 SASI_Hs02_00516610 predicted 487
8 SASI_Hs02_00516611 predicted 215
9 SASI_Hs02_00516612 predicted 481
10 SASI_Hs02_00516613 predicted 499
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516614 predicted 308
2 SASI_Hs02_00516615 predicted 329
3 SASI_Hs02_00516616 predicted 284
4 SASI_Hs02_00516617 predicted 540
5 SASI_Hs02_00516618 predicted 221
6 SASI_Hs02_00516619 predicted 230
7 SASI_Hs02_00516620 predicted 495
8 SASI_Hs02_00516621 predicted 207
9 SASI_Hs02_00516622 predicted 483
10 SASI_Hs02_00516623 predicted 503
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00516624 predicted 302
2 SASI_Hs02_00516625 predicted 336
3 SASI_Hs02_00516626 predicted 292
4 SASI_Hs02_00516627 predicted 538
5 SASI_Hs02_00516628 predicted 226
6 SASI_Hs02_00516629 predicted 225
7 SASI_Hs02_00516630 predicted 495
8 SASI_Hs02_00516631 predicted 207
9 SASI_Hs02_00516632 predicted 478
10 SASI_Hs02_00516633 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019278 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038917 predicted 316
2 SASI_Rn01_00038918 predicted 492
3 SASI_Rn01_00038919 predicted 239
4 SASI_Rn01_00038920 predicted 312
5 SASI_Rn01_00038921 predicted 304
6 SASI_Rn01_00038922 predicted 388
7 SASI_Rn01_00038923 predicted 298
8 SASI_Rn01_00038924 predicted 213
9 SASI_Rn01_00038925 predicted 479
10 SASI_Rn01_00038926 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009049 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176157 predicted 479
2 SASI_Mm01_00176158 predicted 308
3 SASI_Mm01_00176159 predicted 198
4 SASI_Mm01_00176160 predicted 429
5 SASI_Mm01_00176161 predicted 276
6 SASI_Mm01_00176162 predicted 237
7 SASI_Mm01_00176163 predicted 416
8 SASI_Mm02_00315213 predicted 220
9 SASI_Mm01_00176164 predicted 289
10 SASI_Mm01_00176165 predicted 294
11 SASI_Mm01_00176166 predicted 494
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009049
RESP18 MISSION shRNA Bacterial Glycerol Stock
regulated endocrine-specific protein 18
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009049.1-308s1c1
Sequence:CCGGGCCTATGAGTTAATGACCAAACTCGAGTTTGGTCATTAACTCATAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009049.1-485s1c1
Sequence:CCGGGACCGATGCTTTACCACCAAACTCGAGTTTGGTGGTAAAGCATCGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009049.1-241s1c1
Sequence:CCGGCTTCCAGTACTTACAACTTATCTCGAGATAAGTTGTAAGTACTGGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009049.1-254s1c1
Sequence:CCGGCAACTTATATTCCACCAGATTCTCGAGAATCTGGTGGAATATAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009049.1-428s1c1
Sequence:CCGGGAGGAGAAACTTCAACTCTTACTCGAGTAAGAGTTGAAGTTTCTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009049.1-239s1c1
Sequence:CCGGGTCTTCCAGTACTTACAACTTCTCGAGAAGTTGTAAGTACTGGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009049
RESP18 MISSION shRNA shRNA Plasmid DNA
regulated endocrine-specific protein 18
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009049.1-308s1c1
Sequence:CCGGGCCTATGAGTTAATGACCAAACTCGAGTTTGGTCATTAACTCATAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000189686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009049.1-485s1c1
Sequence:CCGGGACCGATGCTTTACCACCAAACTCGAGTTTGGTGGTAAAGCATCGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009049.1-241s1c1
Sequence:CCGGCTTCCAGTACTTACAACTTATCTCGAGATAAGTTGTAAGTACTGGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009049.1-254s1c1
Sequence:CCGGCAACTTATATTCCACCAGATTCTCGAGAATCTGGTGGAATATAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009049.1-428s1c1
Sequence:CCGGGAGGAGAAACTTCAACTCTTACTCGAGTAAGAGTTGAAGTTTCTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009049.1-239s1c1
Sequence:CCGGGTCTTCCAGTACTTACAACTTCTCGAGAAGTTGTAAGTACTGGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009049
RESP18 MISSION shRNA Lentiviral Transduction Particles
regulated endocrine-specific protein 18
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009049.1-308s1c1
Sequence:CCGGGCCTATGAGTTAATGACCAAACTCGAGTTTGGTCATTAACTCATAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000189686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009049.1-485s1c1
Sequence:CCGGGACCGATGCTTTACCACCAAACTCGAGTTTGGTGGTAAAGCATCGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009049.1-241s1c1
Sequence:CCGGCTTCCAGTACTTACAACTTATCTCGAGATAAGTTGTAAGTACTGGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009049.1-254s1c1
Sequence:CCGGCAACTTATATTCCACCAGATTCTCGAGAATCTGGTGGAATATAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009049.1-428s1c1
Sequence:CCGGGAGGAGAAACTTCAACTCTTACTCGAGTAAGAGTTGAAGTTTCTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009049.1-239s1c1
Sequence:CCGGGTCTTCCAGTACTTACAACTTCTCGAGAAGTTGTAAGTACTGGAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007089
RESP18 MISSION shRNA Bacterial Glycerol Stock
regulated endocrine-specific protein 18
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007089.1-184s1c1
Sequence:CCGGGTTGTGCTCCAGCAGATTATACTCGAGTATAATCTGCTGGAGCACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007089.1-417s1c1
Sequence:CCGGCAACCCTGTCAAGATTACCTACTCGAGTAGGTAATCTTGACAGGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007089.1-236s1c1
Sequence:CCGGCCCAGGATGCAATGATCCAAACTCGAGTTTGGATCATTGCATCCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007089.1-364s1c1
Sequence:CCGGGATCAGTGCTTTACCTCCGAACTCGAGTTCGGAGGTAAAGCACTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007089.1-416s1c1
Sequence:CCGGCCAACCCTGTCAAGATTACCTCTCGAGAGGTAATCTTGACAGGGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007089.1-286s1c1
Sequence:CCGGCAAGAACCATGCCTGAAGGATCTCGAGATCCTTCAGGCATGGTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007089.1-208s1c1
Sequence:CCGGCAAGGTCTGTTCTGGAAGGATCTCGAGATCCTTCCAGAACAGACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007089.1-424s1c1
Sequence:CCGGGTCAAGATTACCTATAGGTGTCTCGAGACACCTATAGGTAATCTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007089.1-481s1c1
Sequence:CCGGCCCTCTAAGGAAGAAATTATCCTCGAGGATAATTTCTTCCTTAGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007089
RESP18 MISSION shRNA shRNA Plasmid DNA
regulated endocrine-specific protein 18
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007089.1-184s1c1
Sequence:CCGGGTTGTGCTCCAGCAGATTATACTCGAGTATAATCTGCTGGAGCACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007089.1-417s1c1
Sequence:CCGGCAACCCTGTCAAGATTACCTACTCGAGTAGGTAATCTTGACAGGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000122738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007089.1-236s1c1
Sequence:CCGGCCCAGGATGCAATGATCCAAACTCGAGTTTGGATCATTGCATCCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007089.1-364s1c1
Sequence:CCGGGATCAGTGCTTTACCTCCGAACTCGAGTTCGGAGGTAAAGCACTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007089.1-416s1c1
Sequence:CCGGCCAACCCTGTCAAGATTACCTCTCGAGAGGTAATCTTGACAGGGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007089.1-286s1c1
Sequence:CCGGCAAGAACCATGCCTGAAGGATCTCGAGATCCTTCAGGCATGGTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007089.1-208s1c1
Sequence:CCGGCAAGGTCTGTTCTGGAAGGATCTCGAGATCCTTCCAGAACAGACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000145462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007089.1-424s1c1
Sequence:CCGGGTCAAGATTACCTATAGGTGTCTCGAGACACCTATAGGTAATCTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000144187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007089.1-481s1c1
Sequence:CCGGCCCTCTAAGGAAGAAATTATCCTCGAGGATAATTTCTTCCTTAGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007089
RESP18 MISSION shRNA Lentiviral Transduction Particles
regulated endocrine-specific protein 18
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007089.1-184s1c1
Sequence:CCGGGTTGTGCTCCAGCAGATTATACTCGAGTATAATCTGCTGGAGCACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007089.1-417s1c1
Sequence:CCGGCAACCCTGTCAAGATTACCTACTCGAGTAGGTAATCTTGACAGGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000122738    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007089.1-236s1c1
Sequence:CCGGCCCAGGATGCAATGATCCAAACTCGAGTTTGGATCATTGCATCCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140022    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007089.1-364s1c1
Sequence:CCGGGATCAGTGCTTTACCTCCGAACTCGAGTTCGGAGGTAAAGCACTGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139686    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007089.1-416s1c1
Sequence:CCGGCCAACCCTGTCAAGATTACCTCTCGAGAGGTAATCTTGACAGGGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139285    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007089.1-286s1c1
Sequence:CCGGCAAGAACCATGCCTGAAGGATCTCGAGATCCTTCAGGCATGGTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139214    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007089.1-208s1c1
Sequence:CCGGCAAGGTCTGTTCTGGAAGGATCTCGAGATCCTTCCAGAACAGACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000145462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007089.1-424s1c1
Sequence:CCGGGTCAAGATTACCTATAGGTGTCTCGAGACACCTATAGGTAATCTTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000144187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007089.1-481s1c1
Sequence:CCGGCCCTCTAAGGAAGAAATTATCCTCGAGGATAATTTCTTCCTTAGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)