EMAIL THIS PAGE TO A FRIEND

REST

RE1-silencing transcription factor

41 Gene Product Result for
Synonyms: NRSF XBR
Gene ID:
Human(5978) Summary: This gene encodes a transcriptional repressor that represses neuronal genes in non-neuronal tissues. It is a member of the Kruppel-type zinc finger transcription factor family. It represses transcription by binding a DNA sequence element called the neuron-restrictive silencer element. The protein is also found in undifferentiated neuronal progenitor cells and it is thought that this repressor may act as a master negative regular of neurogenesis. Alternatively spliced transcript variants have been described [provided by RefSeq, Jul 2010]
Mouse(19712) RE1-silencing transcription factor
Rat(83618) RE1-silencing transcription factor
cow(507148) RE1-silencing transcription factor
cow(615792) RE1-silencing transcription factor
naked mole-rat(101718905) RE1-silencing transcription factor
Domestic Rabbit(100341801) RE1-silencing transcription factor
domestic guinea pig(100729177) RE1-silencing transcription factor
Zebrafish(564772) RE1-silencing transcription factor
domestic cat(101086719) RE1-silencing transcription factor
dog(482163) RE1-silencing transcription factor
chicken(422623) RE1-silencing transcription factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011263 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011263 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011263 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005612 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005612 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005612 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005612 Rosetta Predictions human pricing
NM_031788 Rosetta Predictions rat pricing
NM_011263 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141368 predicted 2891
2 SASI_Hs01_00141369 predicted 3410
3 SASI_Hs01_00141370 predicted 1353
4 SASI_Hs01_00141371 predicted 2623
5 SASI_Hs01_00141372 predicted 809
6 SASI_Hs01_00141373 predicted 3378
7 SASI_Hs01_00141374 predicted 1297
8 SASI_Hs01_00141375 predicted 1030
9 SASI_Hs01_00141376 predicted 1075
10 SASI_Hs01_00141377 predicted 2845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031788 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040247 predicted 1468
2 SASI_Rn01_00040248 predicted 997
3 SASI_Rn01_00040249 predicted 381
4 SASI_Rn01_00040250 predicted 2961
5 SASI_Rn01_00040251 predicted 656
6 SASI_Rn01_00040252 predicted 772
7 SASI_Rn01_00040253 predicted 500
8 SASI_Rn01_00040254 predicted 673
9 SASI_Rn01_00040255 predicted 1032
10 SASI_Rn02_00265229 predicted 2463
11 SASI_Rn01_00040256 predicted 739
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011263 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196017 predicted 973
2 SASI_Mm01_00196018 predicted 670
3 SASI_Mm01_00196019 predicted 2967
4 SASI_Mm02_00320271 predicted 516
5 SASI_Mm02_00320272 predicted 661
6 SASI_Mm01_00196022 predicted 1006
7 SASI_Mm01_00196023 predicted 215
8 SASI_Mm01_00196024 predicted 649
9 SASI_Mm01_00196025 predicted 1640
10 SASI_Mm01_00196026 predicted 476
11 SASI_Mm01_00196020 predicted 382
12 SASI_Mm01_00196021 predicted 1731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011263
VALIDATED
REST MISSION shRNA Bacterial Glycerol Stock
RE1-silencing transcription factor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011263.1-379s21c1
Sequence:CCGGGAAATATACAGCGCCAATAAACTCGAGTTTATTGGCGCTGTATATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011263.1-1173s1c1
Sequence:CCGGCGCGGCTTCTAAGAAGTGTAACTCGAGTTACACTTCTTAGAAGCCGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011263.1-889s1c1
Sequence:CCGGCGCCCGTATAAATGTGAACTTCTCGAGAAGTTCACATTTATACGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011263.1-376s1c1
Sequence:CCGGCCAGAAATATACAGCGCCAATCTCGAGATTGGCGCTGTATATTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011263.1-1762s1c1
Sequence:CCGGCCCAAGACAAAGACAAGTAAACTCGAGTTTACTTGTCTTTGTCTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000071347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011263.1-642s1c1
Sequence:CCGGCCGCTGTGGATACAATACCAACTCGAGTTGGTATTGTATCCACAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011263.1-1052s21c1
Sequence:CCGGACGGGCCTAAACCTCTTAATTCTCGAGAATTAAGAGGTTTAGGCCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011263.1-638s21c1
Sequence:CCGGGTGACCGCTGTGGATACAATACTCGAGTATTGTATCCACAGCGGTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011263.1-880s21c1
Sequence:CCGGACAGGAGAACGCCCGTATAAACTCGAGTTTATACGGGCGTTCTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000321488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011263.1-1188s21c1
Sequence:CCGGGTGTAATCTACAATACCATTTCTCGAGAAATGGTATTGTAGATTACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011263
VALIDATED
REST MISSION shRNA shRNA Plasmid DNA
RE1-silencing transcription factor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011263.1-379s21c1
Sequence:CCGGGAAATATACAGCGCCAATAAACTCGAGTTTATTGGCGCTGTATATTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000071343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011263.1-1173s1c1
Sequence:CCGGCGCGGCTTCTAAGAAGTGTAACTCGAGTTACACTTCTTAGAAGCCGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000071345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011263.1-889s1c1
Sequence:CCGGCGCCCGTATAAATGTGAACTTCTCGAGAAGTTCACATTTATACGGGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000071344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011263.1-376s1c1
Sequence:CCGGCCAGAAATATACAGCGCCAATCTCGAGATTGGCGCTGTATATTTCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000071346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011263.1-1762s1c1
Sequence:CCGGCCCAAGACAAAGACAAGTAAACTCGAGTTTACTTGTCTTTGTCTTGGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000071347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011263.1-642s1c1
Sequence:CCGGCCGCTGTGGATACAATACCAACTCGAGTTGGTATTGTATCCACAGCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000321484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011263.1-1052s21c1
Sequence:CCGGACGGGCCTAAACCTCTTAATTCTCGAGAATTAAGAGGTTTAGGCCCGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000321487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011263.1-638s21c1
Sequence:CCGGGTGACCGCTGTGGATACAATACTCGAGTATTGTATCCACAGCGGTCACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000321416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011263.1-880s21c1
Sequence:CCGGACAGGAGAACGCCCGTATAAACTCGAGTTTATACGGGCGTTCTCCTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000321488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011263.1-1188s21c1
Sequence:CCGGGTGTAATCTACAATACCATTTCTCGAGAAATGGTATTGTAGATTACACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011263
VALIDATED
REST MISSION shRNA Lentiviral Transduction Particles
RE1-silencing transcription factor
Mouse
10 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000321485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011263.1-379s21c1
Sequence:CCGGGAAATATACAGCGCCAATAAACTCGAGTTTATTGGCGCTGTATATTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011263.1-1173s1c1
Sequence:CCGGCGCGGCTTCTAAGAAGTGTAACTCGAGTTACACTTCTTAGAAGCCGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011263.1-889s1c1
Sequence:CCGGCGCCCGTATAAATGTGAACTTCTCGAGAAGTTCACATTTATACGGGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011263.1-376s1c1
Sequence:CCGGCCAGAAATATACAGCGCCAATCTCGAGATTGGCGCTGTATATTTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011263.1-1762s1c1
Sequence:CCGGCCCAAGACAAAGACAAGTAAACTCGAGTTTACTTGTCTTTGTCTTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000071347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011263.1-642s1c1
Sequence:CCGGCCGCTGTGGATACAATACCAACTCGAGTTGGTATTGTATCCACAGCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011263.1-1052s21c1
Sequence:CCGGACGGGCCTAAACCTCTTAATTCTCGAGAATTAAGAGGTTTAGGCCCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011263.1-638s21c1
Sequence:CCGGGTGACCGCTGTGGATACAATACTCGAGTATTGTATCCACAGCGGTCACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011263.1-880s21c1
Sequence:CCGGACAGGAGAACGCCCGTATAAACTCGAGTTTATACGGGCGTTCTCCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000321488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011263.1-1188s21c1
Sequence:CCGGGTGTAATCTACAATACCATTTCTCGAGAAATGGTATTGTAGATTACACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005612
REST MISSION shRNA Bacterial Glycerol Stock
RE1-silencing transcription factor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005612.3-1083s1c1
Sequence:CCGGCGAGTCTACAAGTGTATCATTCTCGAGAATGATACACTTGTAGACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005612.3-1368s1c1
Sequence:CCGGGCCTCTAATCAACATGAAGTACTCGAGTACTTCATGTTGATTAGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005612.3-1316s1c1
Sequence:CCGGGCGTACTCATTCAGGTGAGAACTCGAGTTCTCACCTGAATGAGTACGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005612.3-3339s1c1
Sequence:CCGGGCAGCAAATGAGTCTCAGGAACTCGAGTTCCTGAGACTCATTTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005612.3-2853s1c1
Sequence:CCGGGTCCTTATTGAAGTTGGCTTACTCGAGTAAGCCAACTTCAATAAGGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005612.3-1021s21c1
Sequence:CCGGCTAATCGATATGATCACTATACTCGAGTATAGTGATCATATCGATTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005612.3-1580s21c1
Sequence:CCGGGCATCCTACTTGTCCTAATAACTCGAGTTATTAGGACAAGTAGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005612.3-3085s21c1
Sequence:CCGGTCAACGAATCTACCCATATTTCTCGAGAAATATGGGTAGATTCGTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005612
REST MISSION shRNA shRNA Plasmid DNA
RE1-silencing transcription factor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005612.3-1083s1c1
Sequence:CCGGCGAGTCTACAAGTGTATCATTCTCGAGAATGATACACTTGTAGACTCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000014785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005612.3-1368s1c1
Sequence:CCGGGCCTCTAATCAACATGAAGTACTCGAGTACTTCATGTTGATTAGAGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000014784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005612.3-1316s1c1
Sequence:CCGGGCGTACTCATTCAGGTGAGAACTCGAGTTCTCACCTGAATGAGTACGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000014787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005612.3-3339s1c1
Sequence:CCGGGCAGCAAATGAGTCTCAGGAACTCGAGTTCCTGAGACTCATTTGCTGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000014786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005612.3-2853s1c1
Sequence:CCGGGTCCTTATTGAAGTTGGCTTACTCGAGTAAGCCAACTTCAATAAGGACTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000436671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005612.3-1021s21c1
Sequence:CCGGCTAATCGATATGATCACTATACTCGAGTATAGTGATCATATCGATTAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000425937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005612.3-1580s21c1
Sequence:CCGGGCATCCTACTTGTCCTAATAACTCGAGTTATTAGGACAAGTAGGATGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000432087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005612.3-3085s21c1
Sequence:CCGGTCAACGAATCTACCCATATTTCTCGAGAAATATGGGTAGATTCGTTGATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005612
REST MISSION shRNA Lentiviral Transduction Particles
RE1-silencing transcription factor
Human
8 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000014783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005612.3-1083s1c1
Sequence:CCGGCGAGTCTACAAGTGTATCATTCTCGAGAATGATACACTTGTAGACTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005612.3-1368s1c1
Sequence:CCGGGCCTCTAATCAACATGAAGTACTCGAGTACTTCATGTTGATTAGAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005612.3-1316s1c1
Sequence:CCGGGCGTACTCATTCAGGTGAGAACTCGAGTTCTCACCTGAATGAGTACGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005612.3-3339s1c1
Sequence:CCGGGCAGCAAATGAGTCTCAGGAACTCGAGTTCCTGAGACTCATTTGCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005612.3-2853s1c1
Sequence:CCGGGTCCTTATTGAAGTTGGCTTACTCGAGTAAGCCAACTTCAATAAGGACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005612.3-1021s21c1
Sequence:CCGGCTAATCGATATGATCACTATACTCGAGTATAGTGATCATATCGATTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005612.3-1580s21c1
Sequence:CCGGGCATCCTACTTGTCCTAATAACTCGAGTTATTAGGACAAGTAGGATGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005612.3-3085s21c1
Sequence:CCGGTCAACGAATCTACCCATATTTCTCGAGAAATATGGGTAGATTCGTTGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)